HUGE

Gene/Protein Characteristic Table for KIAA0139

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00423
Accession No. :	D50929
Description :	Eukaryotic translation initiation factor 3 subunit 10.
HUGO Gene Name :	eukaryotic translation initiation factor 3, subunit A (EIF3A)
Clone Name :	ha04032 [Vector Info]
Flexi ORF Clone :	pF1KSDA0139
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5276 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 999 bp

Genome contig ID gi89161187r_120684543
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TTCTTCAGTGATAAATAAAATACTTACAGAATTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TTTTAGTGTTGATTTGTGGTTATAGTATTTTGTTTATAATGGTAAGTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 r 120784543 120830306 22 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1388 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14152	100.0	Eukaryotic tran...	Homo sapiens
AAI14430	99.9	Eukaryotic tran...	Homo sapiens
XP_001153575	99.9	eukaryotic tran...	Pan troglodytes
BAG63833	99.7	unnamed protein...	Homo sapiens
XP_884395	94.7	eukaryotic tran...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000717 371 501 PF01399 Proteasome component region PCI

HMMSmart IPR000717 432 512 SM00088 Proteasome component region PCI

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000717	371	501	PF01399	Proteasome component region PCI
HMMSmart	IPR000717	432	512	SM00088	Proteasome component region PCI

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: Stanford G3
Primer_f	: ACCGAGAAAGAGACCGAGACC
Primer_r	: GTCCATCCATCTTCATCAGTC
PCR product length	: 121 bp
PCR conditions	: 95 °C15 sec64 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	999 bp
Genome contig ID	gi89161187r_120684543
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTCTTCAGTGATAAATAAAATACTTACAGAATTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTTTAGTGTTGATTTGTGGTTATAGTATTTTGTTTATAATGGTAAGTTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	r	120784543	120830306	22	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0139

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information