ROUGE

Gene/Protein Characteristic Table for mKIAA0139

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172899
Description :	Eukaryotic translation initiation factor 3 subunit 10.
Clone Name :	mpj01050 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2667 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 0 bp

Genome contig ID gi65553144r_60269182
PolyA signal sequence
(AAGAAA,-10)
+----*----+----*----+----*----+----
ACTTAGAGAGTATCAGGAGCGAGTCAAGAAACTAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAGAAGTAGAAAGGAAAAAGCGGCAAAGAGAGCTGGAAATTGAAGAAAGG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0139 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0139	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 96..2666
Length: 857 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_034253	100.0	eukaryotic tran...	Mus musculus
P23116	99.8	Eukaryotic tran...	Mus musculus
XP_001928377	98.9	similar to LOC5...	Sus scrofa
XP_884395	98.9	eukaryotic tran...	Bos taurus
XP_544044	98.8	similar to euka...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000717 371 501 PF01399 Proteasome component region PCI

HMMSmart IPR000717 432 512 SM00088 Proteasome component region PCI

ProfileScan IPR000717 411 501 PS50250 Proteasome component region PCI

NULL 582 852 PS50313 NULL

IPR002017 676 787 PS50083 Spectrin repeat

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000717	371	501	PF01399	Proteasome component region PCI
HMMSmart	IPR000717	432	512	SM00088	Proteasome component region PCI
ProfileScan	IPR000717	411	501	PS50250	Proteasome component region PCI
NULL	582	852	PS50313	NULL
IPR002017	676	787	PS50083	Spectrin repeat

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	0 bp
Genome contig ID	gi65553144r_60269182
PolyA signal sequence (AAGAAA,-10)	+--------+--------+----*----+---- ACTTAGAGAGTATCAGGAGCGAGTCAAGAAACTAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGAAGTAGAAAGGAAAAAGCGGCAAAGAGAGCTGGAAATTGAAGAAAGG

Gene/Protein Characteristic Table for mKIAA0139

Features of the cloned DNA sequence

Features of the protein sequence