HUGE |
Gene/Protein Characteristic Table for KIAA0137 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00422 |
---|---|
Accession No. : | D50927 |
Description : | Serine/threonine-protein kinase tousled-like 1. |
HUGO Gene Name : | tousled-like kinase 1 (TLK1) |
Clone Name : | ha02915s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0137
![]() |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha02915, former representative clones for KIAA0137 with ha02915s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4122 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1716 bp Genome contig ID gi89161199r_171456816 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
AAAAATCAGCTGAATAAATTCCTTAAGTATACTTCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAGACAAGTGTAAATTGTTTCAAGCTGTTAAAGTTAAACCTAATAACCAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 r 171556816 171725289 21 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 801 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 2 |
: Stanford G3 | |
: ATCCCCTACACCCCCTTCTTC | |
: GTCATCCTTCCTTCACTGCTC | |
: 277 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |