| HUGE |
Gene/Protein Characteristic Table for KIAA0128 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00023 |
|---|---|
| Accession No. : | D50918 |
| Description : | Septin-6. |
| HUGO Gene Name : | septin 6 (SEPT6) |
| Clone Name : | ha03961 [Vector Info] |
| Flexi ORF Clone : | pF1KA0128
![]() |
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4612 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3335 bp Genome contig ID gi89161218r_118534939 PolyA signal sequence
(ATTAAA,-18) +----*----+----*----+----*----+----
ATATGTGCTTGTTTTTAATTAAAACAAGAAGCTTTFlanking genome sequence
(258722 - 258673) ----+----*----+----*----+----*----+----*----+----*
ACAGGAAGTAGTGAATAGGAATGAGGCTGGAGAGGTAAGCAGACGCCAGA
Features of the protein sequence |
Description | |
|---|---|---|
Length: 424 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : X |
| : Stanford G3 | |
| : CCTTAACCCAATGACCCAGTG | |
| : CTACAGTGAGAAAAGCTACCC | |
| : 194 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |