HUGE

Gene/Protein Characteristic Table for KIAA0991

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06774
Accession No. :	AB023208
Description :	Septin-9.
HUGO Gene Name :	septin 9 (SEPT9)
Clone Name :	hk06065 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3938 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1937 bp

Genome contig ID gi51511734f_72783760
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
TTCCTGAAATAAATGTTTCAAATGCAGAAACCCAG
Flanking genome sequence
(224513 - 224562)
----+----*----+----*----+----*----+----*----+----*
AAGGCTCCTGAGTGAGAATGTTTTTTCTGCCCCTGAAGTGCAGTTCTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 72883760 73008271 11 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 630 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAC42221	5.2e-166	99.1	OVARIAN/Breast ...	Homo sapiens
AAD39749	6.3e-166	99.6	MLL septin-like...	Homo sapiens
AAP36691	6.3e-166	99.6	MLL septin-like...	synthetic construct
BAG62031	7.9e-166	100.0	unnamed protein...	Homo sapiens
NP_001106965	8e-166	98.9	septin 9 isofor...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D63878	3.9e-23	46.5	KIAA0158
D50918	6.8e-20	44.4	KIAA0128
D86957	8.9e-20	41.2	KIAA0202

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000038 447 505 PD002565 Cell division/GTP binding protein

HMMPfam IPR000038 339 618 PF00735 Cell division/GTP binding protein

ScanRegExp IPR001998 267 274 PS00172 Xylose isomerase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000038	447	505	PD002565	Cell division/GTP binding protein
HMMPfam	IPR000038	339	618	PF00735	Cell division/GTP binding protein
ScanRegExp	IPR001998	267	274	PS00172	Xylose isomerase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGCGAGAAGGAGTGTATGAG

Primer_r
: GCAAAAACATGGCAAGTCGGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: CCR
Primer_f	: CAGCGAGAAGGAGTGTATGAG
Primer_r	: GCAAAAACATGGCAAGTCGGC
PCR product length	: 147 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1937 bp
Genome contig ID	gi51511734f_72783760
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TTCCTGAAATAAATGTTTCAAATGCAGAAACCCAG
Flanking genome sequence (224513 - 224562)	----+--------+--------+--------+--------+----* AAGGCTCCTGAGTGAGAATGTTTTTTCTGCCCCTGAAGTGCAGTTCTTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	72883760	73008271	11	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0991

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information