HUGE

Gene/Protein Characteristic Table for KIAA0127

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00419
Accession No. :	D50917
Description :	SERTA domain-containing protein 2.
HUGO Gene Name :	SERTA domain containing 2 (SERTAD2)
Clone Name :	ha03921 [Vector Info]
Flexi ORF Clone :	pF1KSDA0127
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 5544 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4302 bp

Genome contig ID gi89161199r_64612260
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TAGTTTTATATTATACAATAAACAGTTAAAAGATG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGAGAGGCATGCTTGCAGTTTTCTTTTGATGGGAGCTCAATCAGCTTATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 64712260 64734550 2 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 315 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14140	3.2e-114	100.0	SERTA domain-co...	Homo sapiens
XP_515728	3.7e-113	99.0	SERTA domain co...	Pan troglodytes
CAH90183	3.8e-112	98.4	hypothetical pr...	Pongo abelii
XP_001088920	4.5e-111	97.1	SERTA domain co...	Macaca mulatta
XP_001494703	2.2e-99	88.9	similar to SERT...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR009263 41 78 PF06031 SERTA

ProfileScan IPR009263 34 81 PS51053 SERTA

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR009263	41	78	PF06031	SERTA
ProfileScan	IPR009263	34	81	PS51053	SERTA

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TGGACTTCTTTTGGGGATAAC
Primer_r	: TCTCAGGTCTGTGGGGGAAAG
PCR product length	: 165 bp
PCR conditions	: 95 °C15 sec62 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4302 bp
Genome contig ID	gi89161199r_64612260
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TAGTTTTATATTATACAATAAACAGTTAAAAGATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAGAGGCATGCTTGCAGTTTTCTTTTGATGGGAGCTCAATCAGCTTATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	64712260	64734550	2	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0127

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information