HUGE

Gene/Protein Characteristic Table for KIAA0123

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07716
Accession No. :	D50913
Description :	Mitochondrial-processing peptidase alpha subunit, mitochondrial precursor.
HUGO Gene Name :	peptidase (mitochondrial processing) alpha (PMPCA)
Clone Name :	ha01523s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0123
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha01523, former representative clones for KIAA0123 with ha01523s1. (2008/8/27)

Features of the cloned DNA sequence	Description

Length: 2083 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 496 bp

Genome contig ID gi89161216f_138324933
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AGCTTCCCTGGTAATAAAGAGCTGGCATCTTTCTT
Flanking genome sequence
(113102 - 113151)
----+----*----+----*----+----*----+----*----+----*
AGCACGGTGTTTTCCTTCTCGCCTGGGGAGGGGCGGTTCTTAAGGGCTGT

Features of the protein sequence	Description

Length: 528 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH33103	100.0	PMPCA protein [...	Homo sapiens
Q10713	100.0	Mitochondrial-p...	Homo sapiens
AAH22949	99.8	PMPCA protein [...	Homo sapiens
Q5R513	98.7	Mitochondrial-p...	Pongo abelii
CAH93153	98.7	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR011765 80 230 PF00675 Peptidase M16

IPR007863 235 434 PF05193 Peptidase M16

ScanRegExp IPR001431 100 123 PS00143 Peptidase M16

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011765	80	230	PF00675	Peptidase M16
IPR007863	235	434	PF05193	Peptidase M16
ScanRegExp	IPR001431	100	123	PS00143	Peptidase M16

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: Stanford G3
Primer_f	: TTCCCGTGCGTGTTAGTTTGG
Primer_r	: TTCACCTGCTTCCTGGCTTGC
PCR product length	: 279 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	496 bp
Genome contig ID	gi89161216f_138324933
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGCTTCCCTGGTAATAAAGAGCTGGCATCTTTCTT
Flanking genome sequence (113102 - 113151)	----+--------+--------+--------+--------+----* AGCACGGTGTTTTCCTTCTCGCCTGGGGAGGGGCGGTTCTTAAGGGCTGT

Gene/Protein Characteristic Table for KIAA0123

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information