HUGE

Gene/Protein Characteristic Table for KIAA0112

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01588
Accession No. :	D25218
Description :	Ribosome biogenesis regulatory protein homolog.
HUGO Gene Name :	RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) (RRS1)
Clone Name :	ha00609 [Vector Info]
Flexi ORF Clone :	pF1KSDA0112
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 1696 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 494 bp

Genome contig ID gi51511724f_67403817
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TTAAAGATTAAGTAATAAAGATGTCTTATCTAGTG
Flanking genome sequence
(101697 - 101746)
----+----*----+----*----+----*----+----*----+----*
TGACTTTTAACTTTCTGACTACTGGGTAGAAATTGTACTTGAAGCCGGTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 f 67503817 67505512 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 399 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001100635	8.8e-134	97.5	similar to homo...	Macaca mulatta
Q15050	4.7e-126	100.0	Ribosome biogen...	Homo sapiens
XP_001926363	7.3e-121	95.1	similar to RRS1...	Sus scrofa
XP_001494863	2.1e-119	94.5	similar to homo...	Equus caballus
XP_544107	2e-118	94.2	similar to homo...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007023 56 231 PF04939 Ribosomal biogenesis regulatory protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007023	56	231	PF04939	Ribosomal biogenesis regulatory protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: Stanford G3
Primer_f	: CCAAGAGGAGGAAAATGAGCC
Primer_r	: CCTCCTTTTCTCTTGCCACCC
PCR product length	: 166 bp
PCR conditions	: 95 °C15 sec64 °C120 sec32 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	494 bp
Genome contig ID	gi51511724f_67403817
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTAAAGATTAAGTAATAAAGATGTCTTATCTAGTG
Flanking genome sequence (101697 - 101746)	----+--------+--------+--------+--------+----* TGACTTTTAACTTTCTGACTACTGGGTAGAAATTGTACTTGAAGCCGGTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	f	67503817	67505512	1	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0112

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information