HUGE

Gene/Protein Characteristic Table for KIAA0074

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00396
Accession No. :	D38553
Description :	Condensin complex subunit 2.
HUGO Gene Name :
Clone Name :	ha01438 [Vector Info]
Flexi ORF Clone :	pF1KSDA0074
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2726 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 481 bp

Genome contig ID gi89161199f_96271103
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TATAGAATGCTCAAAAATAAAATTCTTAATAATAG
Flanking genome sequence
(132196 - 132245)
----+----*----+----*----+----*----+----*----+----*
AACTGGCAAAATATTTGAGTGTCCACTAGATGAGTATCAGACCTAGTCCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 96365276 96403297 18 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 747 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA07556	100.0	HCAP-H [Homo sa...	Homo sapiens
Q15003	100.0	Condensin compl...	Homo sapiens
AAH24211	99.9	Non-SMC condens...	Homo sapiens
BAF83742	99.7	unnamed protein...	Homo sapiens
XP_001148661	99.3	barren isoform ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR008418 33 746 PF05786 Barren

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR008418	33	746	PF05786	Barren

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: Stanford G3
Primer_f	: GAAGTGGCTGACGAGAAGATG
Primer_r	: CACAAGAACATCAGAGAGGTC
PCR product length	: 174 (4.0k) bp
PCR conditions	: 95 °C15 sec64 °C300 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	481 bp
Genome contig ID	gi89161199f_96271103
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TATAGAATGCTCAAAAATAAAATTCTTAATAATAG
Flanking genome sequence (132196 - 132245)	----+--------+--------+--------+--------+----* AACTGGCAAAATATTTGAGTGTCCACTAGATGAGTATCAGACCTAGTCCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	96365276	96403297	18	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0074

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information