ROUGE |
Gene/Protein Characteristic Table for mKIAA0074 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129047 |
---|---|
Condensin subunit 2. | |
mpj01265 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2226 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 390 bp Genome contig ID gi66880554r_126517685 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
GTGTATTTAATACCCCAAAATAAAACTATTCTGGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAGTGTCTGAGTGCCCAGTAAACAGTCAGTATTAGCGTCACACACACACA
KIAA Alignment based on: KIAA0074 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..1836
Length: 611 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |