| HUGE |
Gene/Protein Characteristic Table for KIAA0048 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00384 |
|---|---|
| Accession No. : | D28588 |
| Description : | Transcription factor Sp2. |
| HUGO Gene Name : | Sp2 transcription factor (SP2) |
| Clone Name : | ha01311 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0048
|
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3288 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1133 bp Genome contig ID gi51511734f_43229973 PolyA signal sequence
(AATAAA,-31)
TGCTAATAAATTTAGTTGCCTGAGGCAAAATCTTCFlanking genome sequence
(131349 - 131398)
AACTTGGCAGTTCGGCTTCCTTTGTCTTTTCCCTTGGAGAGCTCGGAGAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 43329973 43361320 7 99.3 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 627 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 17 |
| : Stanford G3 | |
| : TTCCTTTCCTTGTTATTCACC | |
| : AGGTGCTGTTATCTGAATCCA | |
| : 151 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
