| HUGE |
Gene/Protein Characteristic Table for KIAA1962 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00958 |
|---|---|
| Accession No. : | AB075842 |
| Description : | Zinc finger protein 483. |
| HUGO Gene Name : | zinc finger protein 483 (ZNF483) |
| Clone Name : | hm00158 [Vector Info] |
| Flexi ORF Clone : | pF1KA1962
|
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3655 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1262 bp Genome contig ID gi89161216f_113229366 PolyA signal sequence
(ACTAAA,-21)
TTAGGGCATTTCATACTAAAAACAAAGCTTGTCTTFlanking genome sequence
(117169 - 117218)
AAAAAAAATTATAAGGGCTAACAACACTGGGCTTTTATTTATGTAAAGCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 f 113327334 113346533 6 99.2 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 746 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : TGGAAAACCTCAGGAACCTAG | |
| : AAAGCTGATTCATCTAGTCGG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 9 |
| : genbank | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
