HUGE

Gene/Protein Characteristic Table for KIAA1962

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00958
Accession No. :	AB075842
Description :	Zinc finger protein 483.
HUGO Gene Name :	zinc finger protein 483 (ZNF483)
Clone Name :	hm00158 [Vector Info]
Flexi ORF Clone :	pF1KA1962
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 3655 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1262 bp

Genome contig ID gi89161216f_113229366
PolyA signal sequence
(ACTAAA,-21)
+----*----+----*----+----*----+----
TTAGGGCATTTCATACTAAAAACAAAGCTTGTCTT
Flanking genome sequence
(117169 - 117218)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAATTATAAGGGCTAACAACACTGGGCTTTTATTTATGTAAAGCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 113327334 113346533 6 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 746 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI52428	100.0	Zinc finger pro...	Homo sapiens
Q8TF39	99.9	Zinc finger pro...	Homo sapiens
XP_001105826	96.9	zinc finger pro...	Macaca mulatta
XP_528388	94.8	zinc finger pro...	Pan troglodytes
ABM54230	99.5	ZNF483 [Pan pan...	Pan paniscus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046831	3.5e-63	47.9	KIAA1611
AB037852	4.8e-59	39.4	KIAA1431
AB037770	6.3e-59	35.4	KIAA1349
AB058755	1.1e-58	49.4	KIAA1852
AB107355	9.3e-58	41.3	KIAA2033

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 441 464 PD000003 Zinc finger

IPR007087 469 492 PD000003 Zinc finger

IPR007087 497 520 PD000003 Zinc finger

IPR007087 525 548 PD000003 Zinc finger

IPR007087 581 604 PD000003 Zinc finger

IPR007087 637 660 PD000003 Zinc finger

IPR007087 665 688 PD000003 Zinc finger

IPR007087 693 716 PD000003 Zinc finger

HMMPfam IPR003309 48 142 PF02023 Transcriptional regulator SCAN

IPR001909 172 212 PF01352 KRAB box

IPR007087 441 463 PF00096 Zinc finger

IPR007087 469 491 PF00096 Zinc finger

IPR007087 497 519 PF00096 Zinc finger

IPR007087 525 547 PF00096 Zinc finger

IPR007087 553 575 PF00096 Zinc finger

IPR007087 581 603 PF00096 Zinc finger

IPR007087 609 631 PF00096 Zinc finger

IPR007087 637 659 PF00096 Zinc finger

IPR007087 665 687 PF00096 Zinc finger

IPR007087 693 715 PF00096 Zinc finger

IPR007087 721 743 PF00096 Zinc finger

HMMSmart IPR003309 50 158 SM00431 Transcriptional regulator SCAN

IPR001909 172 232 SM00349 KRAB box

IPR015880 441 463 SM00355 Zinc finger

IPR015880 469 491 SM00355 Zinc finger

IPR015880 497 519 SM00355 Zinc finger

IPR015880 525 547 SM00355 Zinc finger

IPR015880 553 575 SM00355 Zinc finger

IPR015880 581 603 SM00355 Zinc finger

IPR015880 609 631 SM00355 Zinc finger

IPR015880 637 659 SM00355 Zinc finger

IPR015880 665 687 SM00355 Zinc finger

IPR015880 693 715 SM00355 Zinc finger

IPR015880 721 743 SM00355 Zinc finger

ProfileScan IPR003309 54 136 PS50804 Transcriptional regulator SCAN

IPR001909 172 243 PS50805 KRAB box

IPR007087 441 468 PS50157 Zinc finger

IPR007087 469 496 PS50157 Zinc finger

IPR007087 497 524 PS50157 Zinc finger

IPR007087 525 552 PS50157 Zinc finger

IPR007087 553 580 PS50157 Zinc finger

IPR007087 581 608 PS50157 Zinc finger

IPR007087 609 636 PS50157 Zinc finger

IPR007087 637 664 PS50157 Zinc finger

IPR007087 665 692 PS50157 Zinc finger

IPR007087 693 720 PS50157 Zinc finger

IPR007087 721 746 PS50157 Zinc finger

ScanRegExp IPR007087 443 463 PS00028 Zinc finger

IPR007087 471 491 PS00028 Zinc finger

IPR007087 499 519 PS00028 Zinc finger

IPR007087 527 547 PS00028 Zinc finger

IPR007087 555 575 PS00028 Zinc finger

IPR007087 583 603 PS00028 Zinc finger

IPR007087 611 631 PS00028 Zinc finger

IPR007087 639 659 PS00028 Zinc finger

IPR007087 667 687 PS00028 Zinc finger

IPR007087 695 715 PS00028 Zinc finger

IPR007087 723 743 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	441	464	PD000003	Zinc finger
IPR007087	469	492	PD000003	Zinc finger
IPR007087	497	520	PD000003	Zinc finger
IPR007087	525	548	PD000003	Zinc finger
IPR007087	581	604	PD000003	Zinc finger
IPR007087	637	660	PD000003	Zinc finger
IPR007087	665	688	PD000003	Zinc finger
IPR007087	693	716	PD000003	Zinc finger
HMMPfam	IPR003309	48	142	PF02023	Transcriptional regulator SCAN
IPR001909	172	212	PF01352	KRAB box
IPR007087	441	463	PF00096	Zinc finger
IPR007087	469	491	PF00096	Zinc finger
IPR007087	497	519	PF00096	Zinc finger
IPR007087	525	547	PF00096	Zinc finger
IPR007087	553	575	PF00096	Zinc finger
IPR007087	581	603	PF00096	Zinc finger
IPR007087	609	631	PF00096	Zinc finger
IPR007087	637	659	PF00096	Zinc finger
IPR007087	665	687	PF00096	Zinc finger
IPR007087	693	715	PF00096	Zinc finger
IPR007087	721	743	PF00096	Zinc finger
HMMSmart	IPR003309	50	158	SM00431	Transcriptional regulator SCAN
IPR001909	172	232	SM00349	KRAB box
IPR015880	441	463	SM00355	Zinc finger
IPR015880	469	491	SM00355	Zinc finger
IPR015880	497	519	SM00355	Zinc finger
IPR015880	525	547	SM00355	Zinc finger
IPR015880	553	575	SM00355	Zinc finger
IPR015880	581	603	SM00355	Zinc finger
IPR015880	609	631	SM00355	Zinc finger
IPR015880	637	659	SM00355	Zinc finger
IPR015880	665	687	SM00355	Zinc finger
IPR015880	693	715	SM00355	Zinc finger
IPR015880	721	743	SM00355	Zinc finger
ProfileScan	IPR003309	54	136	PS50804	Transcriptional regulator SCAN
IPR001909	172	243	PS50805	KRAB box
IPR007087	441	468	PS50157	Zinc finger
IPR007087	469	496	PS50157	Zinc finger
IPR007087	497	524	PS50157	Zinc finger
IPR007087	525	552	PS50157	Zinc finger
IPR007087	553	580	PS50157	Zinc finger
IPR007087	581	608	PS50157	Zinc finger
IPR007087	609	636	PS50157	Zinc finger
IPR007087	637	664	PS50157	Zinc finger
IPR007087	665	692	PS50157	Zinc finger
IPR007087	693	720	PS50157	Zinc finger
IPR007087	721	746	PS50157	Zinc finger
ScanRegExp	IPR007087	443	463	PS00028	Zinc finger
IPR007087	471	491	PS00028	Zinc finger
IPR007087	499	519	PS00028	Zinc finger
IPR007087	527	547	PS00028	Zinc finger
IPR007087	555	575	PS00028	Zinc finger
IPR007087	583	603	PS00028	Zinc finger
IPR007087	611	631	PS00028	Zinc finger
IPR007087	639	659	PS00028	Zinc finger
IPR007087	667	687	PS00028	Zinc finger
IPR007087	695	715	PS00028	Zinc finger
IPR007087	723	743	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGGAAAACCTCAGGAACCTAG

Primer_r
: AAAGCTGATTCATCTAGTCGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1262 bp
Genome contig ID	gi89161216f_113229366
PolyA signal sequence (ACTAAA,-21)	+--------+--------+----*----+---- TTAGGGCATTTCATACTAAAAACAAAGCTTGTCTT
Flanking genome sequence (117169 - 117218)	----+--------+--------+--------+--------+----* AAAAAAAATTATAAGGGCTAACAACACTGGGCTTTTATTTATGTAAAGCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	113327334	113346533	6	99.2	Perfect prediction

Primer_f	: TGGAAAACCTCAGGAACCTAG
Primer_r	: AAAGCTGATTCATCTAGTCGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1962

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information