| HUGE |
Gene/Protein Characteristic Table for KIAA0032 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00376 |
|---|---|
| Accession No. : | D25215 |
| Description : | Probable E3 ubiquitin-protein ligase HERC3. |
| HUGO Gene Name : | hect domain and RLD 3 (HERC3) |
| Clone Name : | ha01920 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0032
|
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4894 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1575 bp Genome contig ID gi89161207f_89632670 PolyA signal sequence
(AATAAA,-22)
TTCAATATTATGCAATAAATTTGGTGTTTTAACTTFlanking genome sequence
(216041 - 216090)
AAAACTATTTCTTATTGTACTTGCAGAATGGATAGCTTGCTTTTAGTAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 4 f 89732670 89848709 26 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1054 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
RH mapping information |
Description | |
|---|---|---|
| : 4 |
| : Genebridge 4 | |
| : CAACCTTCCTCATCATGG | |
| : CTACAATCCTTCATCAAG | |
| : 156 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
