HUGE

Gene/Protein Characteristic Table for KIAA0016

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00364
Accession No. :	D13641
Description :	Mitochondrial import receptor subunit TOM20 homolog.
HUGO Gene Name :	translocase of outer mitochondrial membrane 20 homolog (yeast) (TOMM20)
Clone Name :	ha00489 [Vector Info]
Flexi ORF Clone :	pF1KSDA0016
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3259 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2720 bp

Genome contig ID gi89161185r_233239283
PolyA signal sequence
(ATTAAA,-16)
+----*----+----*----+----*----+----
CTCAACTGTTTAAGTGAATATTAAAGGGCTTGGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAACTTTGGCTTGGCGTATGTTTGGAGAAGTGAACTCTGCTGAATTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 233339283 233358754 5 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 178 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q15388	3.4e-55	100.0	Mitochondrial i...	Homo sapiens
CAG32999	6.3e-55	99.3	TOMM20 [Homo sa...	Homo sapiens
Q9DCC8	6.3e-55	99.3	Mitochondrial i...	Mus musculus
ABW03358	1.2e-54	99.3	translocase of ...	synthetic construct
XP_001491687	1.2e-54	99.3	similar to Mito...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002056 53 70 PR00351 Protein import receptor MAS20

IPR002056 71 83 PR00351 Protein import receptor MAS20

HMMPfam IPR002056 30 175 PF02064 Protein import receptor MAS20

HMMTigr IPR002056 34 160 TIGR00985 Protein import receptor MAS20

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002056	53	70	PR00351	Protein import receptor MAS20
IPR002056	71	83	PR00351	Protein import receptor MAS20
HMMPfam	IPR002056	30	175	PF02064	Protein import receptor MAS20
HMMTigr	IPR002056	34	160	TIGR00985	Protein import receptor MAS20

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GCGAAAGAACATTGAAAACA
Primer_r	: GCAGGTGGGAGGATGGTAAA
PCR product length	: 187 bp
PCR conditions	: 95 °C15 sec58 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2720 bp
Genome contig ID	gi89161185r_233239283
PolyA signal sequence (ATTAAA,-16)	+--------+--------+----*----+---- CTCAACTGTTTAAGTGAATATTAAAGGGCTTGGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAACTTTGGCTTGGCGTATGTTTGGAGAAGTGAACTCTGCTGAATTTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	233339283	233358754	5	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA0016

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information