HUGE

Gene/Protein Characteristic Table for KIAA0005

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04298
Accession No. :	D13630
Description :	basic leucine zipper and W2 domains 1.
HUGO Gene Name :	basic leucine zipper and W2 domains 1 (BZW1)
Clone Name :	ha00071 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 2998 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1658 bp

Genome contig ID gi89161199f_201284890
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TTTTTTTTAAAAAAATAAAGTCCATACTTACACTT
Flanking genome sequence
(111916 - 111965)
----+----*----+----*----+----*----+----*----+----*
AGGCTTTATACATCAGTCTTTTTTTTTTTAAATTCCATGTTAATACCTAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 201384888 201396804 12 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 424 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD96965	3.7e-167	99.8	BZW1 protein va...	Homo sapiens
BAG63019	1.1e-166	100.0	unnamed protein...	Homo sapiens
XP_849107	1.1e-166	100.0	similar to basi...	Canis lupus fam...
XP_001170500	1.1e-166	100.0	basic leucine z...	Pan troglodytes
BAG59710	1.1e-166	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003307 340 420 PF02020 eIF4-gamma/eIF5/eIF2-epsilon

HMMSmart IPR003307 330 415 SM00515 eIF4-gamma/eIF5/eIF2-epsilon

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003307	340	420	PF02020	eIF4-gamma/eIF5/eIF2-epsilon
HMMSmart	IPR003307	330	415	SM00515	eIF4-gamma/eIF5/eIF2-epsilon

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GGTCTCTGGTTTTCATCCTT
Primer_r	: TTGAAAATGGTTGTATGAAA
PCR product length	: 184 bp
PCR conditions	: 95 °C15 sec53 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1658 bp
Genome contig ID	gi89161199f_201284890
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTTTTTTTAAAAAAATAAAGTCCATACTTACACTT
Flanking genome sequence (111916 - 111965)	----+--------+--------+--------+--------+----* AGGCTTTATACATCAGTCTTTTTTTTTTTAAATTCCATGTTAATACCTAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	201384888	201396804	12	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0005

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information