ROUGE

Gene/Protein Characteristic Table for mKIAA0005

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC028865
Description :	basic leucine zipper and W2 domains 1.
Clone Name :	meg01347 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 2817 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1482 bp

Genome contig ID gi65488608f_58598554
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
AAGATTTTTTTTTTTAAAATAAAGTCCATCCTTGC
Flanking genome sequence
(112752 - 112801)
----+----*----+----*----+----*----+----*----+----*
ATTTAGGTTTTATAGATCAGTCTTTTTATTCCCACCCCTCCCCCAGTCGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0005 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0005	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 61..1335
Length: 424 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD96965	2.5e-167	99.8	BZW1 protein va...	Homo sapiens
BAG63019	7.1e-167	100.0	unnamed protein...	Homo sapiens
XP_001170500	7.5e-167	100.0	basic leucine z...	Pan troglodytes
XP_849107	7.5e-167	100.0	similar to basi...	Canis lupus fam...
BAG59710	7.5e-167	100.0	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003307 340 420 PF02020 eIF4-gamma/eIF5/eIF2-epsilon

HMMSmart IPR003307 330 415 SM00515 eIF4-gamma/eIF5/eIF2-epsilon

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003307	340	420	PF02020	eIF4-gamma/eIF5/eIF2-epsilon
HMMSmart	IPR003307	330	415	SM00515	eIF4-gamma/eIF5/eIF2-epsilon

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1482 bp
Genome contig ID	gi65488608f_58598554
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AAGATTTTTTTTTTTAAAATAAAGTCCATCCTTGC
Flanking genome sequence (112752 - 112801)	----+--------+--------+--------+--------+----* ATTTAGGTTTTATAGATCAGTCTTTTTATTCCCACCCCTCCCCCAGTCGC

Gene/Protein Characteristic Table for mKIAA0005

Features of the cloned DNA sequence

Features of the protein sequence