KIAA1726

Product ID	ORK07402
Accession No	AB051513
Description	zinc finger CCCH-type containing 12C
Clone name	pf01109
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7981 bp) Predicted protein sequence (624 aa)
Source	Human brain (hippocampus)
Rouge ID	mKIAA1726 by Kazusa Mouse cDNA Project

Length: 7981 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	6105 bp
Genome contig ID	gi51511727f_109428857
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- AAAATTGAAATTAAATGTCAAAGACAACTAGACAT
Flanking genome sequence (118919 - 118968)	----+--------+--------+--------+--------+----* AACTTAAGGCATGATGAGAGTGTTTTTTTTTCCTGAACCCGTCATTATAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	109528857	109547774	4	99.1	Perfect prediction

Length: 624 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9C0D7	100.0	Zinc finger CCC...	Homo sapiens
BAG61159	100.0	unnamed protein...	Homo sapiens
BAG10484	100.0	zinc finger CCC...	synthetic construct
XP_522175	99.8	zinc finger CCC...	Pan troglodytes
BAG58377	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002321	1e-16	46.6	KIAA0323
AB014515	7.6e-15	50.7	KIAA0615
AB037726	2.7e-12	46.9	KIAA1305

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	TTCCTTGCCCGATAACTCCAC
Primer_r	ACAATTCTCACAAGGTCAGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-