Order Kazusa clone(s) from : ![]() |
Product ID | ORK00505 |
---|---|
Accession No | AB002321 |
Description | KH and NYN domain containing, transcript variant 2 |
Clone name | hg00467 |
Vector information | |
cDNA sequence | DNA sequence (6227 bp) Predicted protein sequence (724 aa) |
HaloTag ORF Clone |
FHC00505
![]() |
Flexi ORF Clone | FXC00505 |
Source | Human adult brain |
Rouge ID |
mKIAA0323
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4051 bp |
---|---|
Genome contig ID | gi51511730f_23868332 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (112050 - 112099) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | f | 23968332 | 23980380 | 8 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
---|
Primer_f | AGGTCATGGAGAAGTTCAAGG |
---|---|
Primer_r | GTAGTAAGCTGCCGGTGGAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AGGTCATGGAGAAGTTCAAGG |
Primer_r | GTAGTAAGCTGCCGGTGGAAC |
PCR product length | 170 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |