Order Kazusa clone(s) from : ![]() |
Product ID | ORK01187 |
---|---|
Accession No | AB075853 |
Description | glutamate receptor, ionotropic, N-methyl-D-aspartate 3A |
Clone name | pf00154 |
Vector information | |
cDNA sequence | DNA sequence (7770 bp) Predicted protein sequence (1176 aa) |
HaloTag ORF Clone |
FHC01187
![]() |
Flexi ORF Clone | FXC01187 |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1973
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 3821 bp |
---|---|
Genome contig ID | gi89161216r_103271456 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | r | 103371456 | 103540683 | 9 | 99.4 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | NULL | 801 | 870 | PD245531 | NULL |
FPrintScan | IPR001508 | 654 | 682 | PR00177 | NMDA receptor |
IPR001508 | 738 | 763 | PR00177 | NMDA receptor | |
IPR001508 | 805 | 832 | PR00177 | NMDA receptor | |
IPR001508 | 992 | 1016 | PR00177 | NMDA receptor | |
HMMPfam | IPR001320 | 735 | 1013 | PF00060 | Ionotropic glutamate receptor |
HMMSmart | IPR001320 | 626 | 971 | SM00079 | Ionotropic glutamate receptor |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 69 | WLLSRVCLLLPPPCALVLAGVP | 90 | PRIMARY | 22 | 2 | 735 | HWTMWLGIFVALHITAVFLTLY | 756 | PRIMARY | 22 | 3 | 773 | KVFSFSSALNICYALLFGRTVAI | 795 | SECONDARY | 23 | 4 | 805 | FLMNLWAIFCMFCLSTYTANLAA | 827 | SECONDARY | 23 | 5 | 990 | KHFSGLFVLLCIGFGLSILTTIG | 1012 | PRIMARY | 23 |
---|
![]() |
Primer_f | CAGTGCTGAAGATTATGTGAG |
---|---|
Primer_r | CACAGTGAGAAGTTTGCAGTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |