Order Kazusa clone(s) from : ![]() |
Product ID | ORK00642 |
---|---|
Accession No | AB018340 |
Description | SUMO1/sentrin specific peptidase 6, transcript variant 1 |
Clone name | hk06406s1 |
Vector information | |
cDNA sequence | DNA sequence (4254 bp) Predicted protein sequence (1126 aa) |
Flexi ORF Clone | FXC00642 |
Source | Human adult brain |
Rouge ID |
mKIAA0797
by Kazusa Mouse cDNA Project
|
Note | We replaced hk06406, former representative clones for KIAA0797 with hk06406s1. (2002/12/27) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 871 bp |
---|---|
Genome contig ID | gi89161210f_76268917 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (213986 - 214035) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | f | 76368917 | 76482901 | 24 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | AGTTCAGAAATAGGACAGTGG |
---|---|
Primer_r | GTGGTACTTTTGGATTAGAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |