Order Kazusa clone(s) from : ![]() |
Product ID | ORK01120 |
---|---|
Accession No | AB018320 |
Description | sorbin and SH3 domain containing 2, transcript variant 2 |
Clone name | hk05279 |
Vector information | |
cDNA sequence | DNA sequence (4118 bp) Predicted protein sequence (1171 aa) |
Flexi ORF Clone | FXC01120 |
Source | Human adult brain |
Rouge ID |
mKIAA0777
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR003127 | 161 | 299 | PD016158 | Sorbin-like |
IPR001452 | 939 | 989 | PD000066 | Src homology-3 | |
IPR001452 | 1014 | 1066 | PD000066 | Src homology-3 | |
IPR001452 | 1117 | 1168 | PD000066 | Src homology-3 | |
FPrintScan | IPR001452 | 937 | 947 | PR00452 | Src homology-3 |
IPR001452 | 951 | 966 | PR00452 | Src homology-3 | |
IPR000108 | 989 | 1006 | PR00499 | Neutrophil cytosol factor 2 | |
IPR000108 | 1027 | 1046 | PR00499 | Neutrophil cytosol factor 2 | |
IPR001452 | 1056 | 1068 | PR00452 | Src homology-3 | |
IPR000108 | 1117 | 1137 | PR00499 | Neutrophil cytosol factor 2 | |
IPR000108 | 1137 | 1153 | PR00499 | Neutrophil cytosol factor 2 | |
HMMPfam | IPR003127 | 138 | 187 | PF02208 | Sorbin-like |
IPR001452 | 937 | 991 | PF00018 | Src homology-3 | |
IPR001452 | 1012 | 1068 | PF00018 | Src homology-3 | |
IPR001452 | 1115 | 1171 | PF00018 | Src homology-3 | |
HMMSmart | IPR003127 | 138 | 188 | SM00459 | Sorbin-like |
IPR001452 | 937 | 992 | SM00326 | Src homology-3 | |
IPR001452 | 1012 | 1069 | SM00326 | Src homology-3 | |
IPR001452 | 1115 | 1171 | SM00326 | Src homology-3 | |
ProfileScan | IPR003127 | 137 | 198 | PS50831 | Sorbin-like |
IPR001452 | 934 | 993 | PS50002 | Src homology-3 | |
IPR001452 | 1009 | 1070 | PS50002 | Src homology-3 | |
IPR001452 | 1112 | 1171 | PS50002 | Src homology-3 | |
ScanRegExp | IPR007087 | 728 | 750 | PS00028 | Zinc finger |
![]() |
Primer_f | AAACTACGTCAAGAGGCTGTG |
---|---|
Primer_r | GAAACCGTAAGGCATGACAAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |