Order Kazusa clone(s) from : 
Japan
||
Other countries |
|
Order Kazusa clone(s) from :
Japan
||
Other countries |
| Product ID | ORK00734 |
|---|---|
| Accession No | AB029010 |
| Description | solute carrier family 8 (sodium/calcium exchanger), member 2 |
| Clone name | hk02378 |
| Vector information |
The cDNA fragment was inserted at the SalI-NotI site of the ...
|
| cDNA sequence | DNA sequence (4282 bp) Predicted protein sequence (952 aa) |
|
HaloTag ORF Clone |
FHC00734
|
| Flexi ORF Clone | FXC00734 |
| Source | Human adult brain |
| Rouge ID |
mKIAA1087
by Kazusa Mouse cDNA Project
|
Length: 4282 bp Physical map
Restriction map Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 1423 bp |
|---|---|
| Genome contig ID | gi42406306r_52523735 |
| PolyA signal sequence (CATAAA,-24) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 19 | r | 52623735 | 52666934 | 10 | 99.6 | Perfect prediction |
Length: 952 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment) |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI) Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| FPrintScan | IPR004836 | 784 | 796 | PR01259 | Sodium/calcium exchanger protein |
| IPR004836 | 797 | 808 | PR01259 | Sodium/calcium exchanger protein | |
| IPR004836 | 810 | 822 | PR01259 | Sodium/calcium exchanger protein | |
| IPR004836 | 823 | 836 | PR01259 | Sodium/calcium exchanger protein | |
| HMMPfam | IPR004837 | 115 | 274 | PF01699 | Sodium/calcium exchanger membrane region |
| IPR003644 | 415 | 514 | PF03160 | Na-Ca exchanger/integrin-beta4 | |
| IPR003644 | 543 | 643 | PF03160 | Na-Ca exchanger/integrin-beta4 | |
| IPR004837 | 788 | 941 | PF01699 | Sodium/calcium exchanger membrane region | |
| HMMSmart | IPR003644 | 415 | 514 | SM00237 | Na-Ca exchanger/integrin-beta4 |
| IPR003644 | 543 | 643 | SM00237 | Na-Ca exchanger/integrin-beta4 | |
| HMMTigr | IPR004836 | 27 | 952 | TIGR00845 | Sodium/calcium exchanger protein |
Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 29 | PPPMAPLALVGVTLLLAAPPCSG | 51 | SECONDARY | 23 | 2 | 105 | VYFVAMVYMFLGVSIIADRFMAA | 127 | PRIMARY | 23 | 3 | 149 | VGTVRIWNETVSNLTLMALGSSA | 171 | SECONDARY | 23 | 4 | 193 | PGTIVGSAAFNMFVVIAVCIYVI | 215 | PRIMARY | 23 | 5 | 226 | LRVFFVTASWSIFAYVWLYLILA | 248 | PRIMARY | 23 | 6 | 256 | QVWEALLTLVFFPVCVVFAWMAD | 278 | PRIMARY | 23 | 7 | 750 | PSCFDYVMHFLTVFWKVLFACVP | 772 | SECONDARY | 23 | 8 | 781 | ACFGVSILVIGLLTALIGDLASH | 803 | PRIMARY | 23 | 9 | 853 | NAVNVFLGLGVAWSVAAVYWAVQ | 875 | PRIMARY | 23 | 10 | 883 | TGTLAFSVTLFTVFAFVGIAVLL | 905 | PRIMARY | 23 | 11 | 924 | LATTALFLGLWLLYILFASLEAY | 946 | PRIMARY | 23 |
|---|
|
RT-PCR-ELISA
|
Experimental conditions| Primer_f | CAGGTGAAGATAGTTGATGAC |
|---|---|
| Primer_r | ATATGACTCCTCGATGATGAC |
| PCR conditions | 95 °C 30 sec55 °C30 sec72 °C60 sec30 cycles |
Chromosome No. 19 Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | CCAGAGGACCAATGCTACAAG |
| Primer_r | GGGCAGGAAACATCAACAGTA |
| PCR product length | 176 bp |
| PCR conditions | 95 °C15 sec64 °C60 sec30 cycles |
Japan
||
Other countries
