KIAA1074

Product ID	ORK00731
Accession No	AB028997
Description	ankyrin repeat domain 26, transcript variant 1
Clone name	hj06637
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5360 bp) Predicted protein sequence (1715 aa)
HaloTag ORF Clone	FHC00731
Flexi ORF Clone	FXC00731
Source	Human adult brain
Rouge ID	mKIAA1074 by Kazusa Mouse cDNA Project

Length: 5360 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	80 bp
Genome contig ID	gi89161187r_27234445
PolyA signal sequence (ATTAAA,-33)	+--------+--------+----*----+---- TCATTAAATATTAATATATGACATGTAAAAATATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGGAACGTATTTTTGTATCATATATGTCAGATCAAAATTTATATAGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	27334445	27429411	34	99.9	Perfect prediction

Length: 1715 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09959	100.0	ankyrin repeat ...	synthetic construct
Q9UPS8	99.9	Ankyrin repeat ...	Homo sapiens
EAW86073	99.9	ankyrin repeat ...	Homo sapiens
CAC19649	99.9	novel protein [...	Homo sapiens
XP_507708	98.9	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011137	1.2e-37	50.5	KIAA0565
AB046861	7.2e-13	46.3	KIAA1641
AB095935	8.4e-13	42.5	KIAA2015
AB046781	4.5e-07	22.2	KIAA1561
AB037755	1.9e-06	21.8	KIAA1334

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	86	98	PR01415	Ankyrin
FPrintScan	IPR002110	131	143	PR01415	Ankyrin
HMMPfam	IPR002110	85	117	PF00023	Ankyrin
	IPR002110	118	150	PF00023	Ankyrin
	IPR002110	151	183	PF00023	Ankyrin
	IPR002110	184	216	PF00023	Ankyrin
HMMSmart	IPR002110	85	114	SM00248	Ankyrin
	IPR002110	118	147	SM00248	Ankyrin
	IPR002110	151	180	SM00248	Ankyrin
	IPR002110	184	213	SM00248	Ankyrin
ProfileScan	IPR002110	51	216	PS50297	Ankyrin
	IPR002110	85	117	PS50088	Ankyrin
	IPR002110	118	150	PS50088	Ankyrin
	IPR002110	151	183	PS50088	Ankyrin
	IPR002110	184	216	PS50088	Ankyrin

Primer_f	GTTCACCACTCTCACTACCAG
Primer_r	TGCTCAAGTAGTTCTCCATGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GTTCACCACTCTCACTACCAG
Primer_r	TGCTCAAGTAGTTCTCCATGC
PCR product length	161 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles