Order Kazusa clone(s) from : ![]() |
Product ID | ORK00805 |
---|---|
Accession No | AB037755 |
Description | retinoic acid induced 14, transcript variant 1 |
Clone name | fh15842 |
Vector information | |
cDNA sequence | DNA sequence (5043 bp) Predicted protein sequence (989 aa) |
HaloTag ORF Clone |
FHC00805
![]() |
Flexi ORF Clone | FXC00805 |
Source | Human fetal brain |
Rouge ID |
mKIAA1334
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1846 bp |
---|---|
Genome contig ID | gi51511721f_34592353 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (276122 - 276171) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 34692353 | 34868473 | 18 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002110 | 62 | 74 | PR01415 | Ankyrin |
IPR002110 | 173 | 185 | PR01415 | Ankyrin | |
HMMPfam | IPR002110 | 27 | 60 | PF00023 | Ankyrin |
IPR002110 | 61 | 93 | PF00023 | Ankyrin | |
IPR002110 | 94 | 126 | PF00023 | Ankyrin | |
IPR002110 | 127 | 159 | PF00023 | Ankyrin | |
IPR002110 | 160 | 192 | PF00023 | Ankyrin | |
IPR002110 | 193 | 225 | PF00023 | Ankyrin | |
IPR002110 | 226 | 261 | PF00023 | Ankyrin | |
HMMSmart | IPR002110 | 61 | 90 | SM00248 | Ankyrin |
IPR002110 | 94 | 126 | SM00248 | Ankyrin | |
IPR002110 | 127 | 156 | SM00248 | Ankyrin | |
IPR002110 | 160 | 189 | SM00248 | Ankyrin | |
IPR002110 | 193 | 222 | SM00248 | Ankyrin | |
IPR002110 | 226 | 256 | SM00248 | Ankyrin | |
ProfileScan | IPR002110 | 27 | 249 | PS50297 | Ankyrin |
IPR002110 | 61 | 93 | PS50088 | Ankyrin | |
IPR002110 | 94 | 126 | PS50088 | Ankyrin | |
IPR002110 | 127 | 159 | PS50088 | Ankyrin | |
IPR002110 | 160 | 192 | PS50088 | Ankyrin | |
IPR002110 | 193 | 225 | PS50088 | Ankyrin |
![]() |
Primer_f | GTGACAGCCCAAGATACTACC |
---|---|
Primer_r | GAGCCGCTGCATAATGTAAAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |