KIAA1641

Product ID	ORK04112
Accession No	AB046861
Description	ankyrin repeat domain 36
Clone name	fj10609s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (2924 bp) Predicted protein sequence (718 aa)
Source	Human fetal brain
Note	We replaced fj10609, former representative clones for KIAA1641 with fj10609s1. (2002/5/10)

Length: 2924 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	103 bp
Genome contig ID	gi89161199f_97142191
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- ATAATTAATGTTATTAAAATTTTATAGTGGATGGC
Flanking genome sequence (135039 - 135088)	----+--------+--------+--------+--------+----* TTTCTTCTGTATTTTCCTTATTATTAATTTTATTAAGATTTTATTATAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	f	97242191	97277228	14	99.1	Perfect prediction
Ensembl gnome browser	2	r	97492331	97527572	14	98.8	Perfect prediction
Ensembl gnome browser	2	r	95883039	95918285	14	97.6	Perfect prediction

Length: 718 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAI46836	0	100.0	ANKRD36B protei...	Homo sapiens
Q8N2N9	2.1e-212	94.4	UPF0634 protein...	Homo sapiens
NP_079466	1.2e-211	94.1	ankyrin repeat ...	Homo sapiens
XP_001714737	2e-207	92.3	protein immuno-...	Homo sapiens
Q5JPF3	3.8e-207	92.2	UPF0634 protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028997	4.4e-17	46.3	KIAA1074
AB011137	1.3e-16	41.8	KIAA0565
AB095935	2.5e-15	32.8	KIAA2015

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	CCAGATGTGATGCTAGAGTAC
Primer_r	CGTTTTTGTTGAAGCTGTCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	CCAGATGTGATGCTAGAGTAC
Primer_r	CGTTTTTGTTGAAGCTGTCTC
PCR product length	178(1.6k) bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles