KIAA1853

Product ID	ORK00288
Accession No	AB058756
Description	serine/arginine repetitive matrix 4
Clone name	hj04155
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5206 bp) Predicted protein sequence (708 aa)
HaloTag ORF Clone	FHC00288
Flexi ORF Clone	FXC00288
Source	Human adult brain
Rouge ID	mKIAA1853 by Kazusa Mouse cDNA Project

Length: 5206 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	Warning

Integrity of 3' end

Length of 3'UTR	3078 bp
Genome contig ID	gi89161190f_117803779
PolyA signal sequence (None)	+--------+--------+----*----+---- TCAGGGGAAAGCACAAAGCTATTTCTGAAATTAGG
Flanking genome sequence (278293 - 278342)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGGTGGAAGGAGCAGCCAGATGTTCCACAGGACCCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	12	f	117903779	118082070	13	99.4	Perfect prediction

Length: 708 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAB01611	3.4e-78	99.3	unnamed protein...	Macaca fascicularis
EDM13842	3e-41	86.2	similar to RIKE...	Rattus norvegicus
CAG08167	6.1e-32	41.6	unnamed protein...	Tetraodon nigro...
NP_001103669	5.5e-26	32.9	hypothetical pr...	Homo sapiens
Q80WV7	1.7e-25	33.5	SRRM2-like protein.	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002322	3.5e-11	31.8	KIAA0324
AB011108	4e-06	26.7	KIAA0536
AB011125	0.001	25.1	KIAA0553

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Primer_f	TGCATGGCTGACACAAAACAC
Primer_r	GGGAATGTTCAGCAGATGGTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGTGGATGAAAATGATGTCTG
Primer_r	GTGATCCTGCTATGTGCCTTG
PCR product length	95 bp
PCR conditions	15 °C62 sec60 °C30 sec150 cycles