KIAA1061

Product ID	ORK05236
Accession No	AB028984
Description	follistatin-like 4
Clone name	hj00491
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4719 bp) Predicted protein sequence (693 aa)
Source	Human adult brain
Rouge ID	mKIAA1061 by Kazusa Mouse cDNA Project

Length: 4719 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2635 bp
Genome contig ID	gi51511721r_132460051
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- CCCCCTCAGTCATTTTGAAATAAAATTAATTTTAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATTCGATAGTTTTTTTTTTCCCAAAATGACAAAAAATCTGCACCTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	5	r	132560051	132680207	12	99.3	Perfect prediction

Length: 693 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_055897	100.0	follistatin-lik...	Homo sapiens
EAW62292	99.9	follistatin-lik...	Homo sapiens
Q6MZW2	99.6	Follistatin-rel...	Homo sapiens
XP_517931	99.3	follistatin-lik...	Pan troglodytes
XP_001107348	97.3	similar to foll...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033089	5.3e-170	60.5	KIAA1263
D86983	1.3e-10	29.1	KIAA0230
AB018349	1.3e-08	25.7	KIAA0806
AB002341	2.7e-08	29.3	KIAA0343
AB037776	4.1e-08	30.3	KIAA1355

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013151	114	174	PF00047	Immunoglobulin
HMMPfam	IPR013098	192	281	PF07679	Immunoglobulin I-set
HMMSmart	IPR003599	106	189	SM00409	Immunoglobulin subtype
	IPR003598	112	179	SM00408	Immunoglobulin subtype 2
	IPR003599	198	282	SM00409	Immunoglobulin subtype
	IPR003598	204	271	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR002048	25	60	PS50222	Calcium-binding EF-hand
	IPR007110	102	189	PS50835	Immunoglobulin-like
	IPR007110	192	277	PS50835	Immunoglobulin-like
	IPR007110	659	693	PS50835	Immunoglobulin-like
ScanRegExp	IPR002048	38	50	PS00018	Calcium-binding EF-hand

Primer_f	CAGCAGAGGTTCATGGGACAC
Primer_r	CATTAGGAGGATTACCGGCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAGCAGAGGTTCATGGGACAC
Primer_r	CATTAGGAGGATTACCGGCTG
PCR product length	100 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles