KIAA1355

Product ID	ORK00813
Accession No	AB037776
Description	immunoglobulin superfamily, member 9, transcript variant 1
Clone name	fj01564
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4036 bp) Predicted protein sequence (1189 aa)
HaloTag ORF Clone	FHC00813
Flexi ORF Clone	FXC00813
Source	Human fetal brain
Rouge ID	mKIAA1355 by Kazusa Mouse cDNA Project

Length: 4036 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	298 bp
Genome contig ID	gi89161185r_158063546
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTTTTTACAGGTGAATAAACAAAGTTTGAAAGATG
Flanking genome sequence (99907 - 99858)	----+--------+--------+--------+--------+----* TTTCTGTGTGTTATCTGTCTTTGAGAGAGTGCCAGGAAAATCCCTGGACC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	158163453	158182010	21	99.6	Perfect prediction

Length: 1189 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2J2	100.0	Protein turtle ...	Homo sapiens
XP_001117344	98.2	similar to immu...	Macaca mulatta
EDL39011	88.0	immunoglobulin ...	Mus musculus
XP_545751	89.4	similar to immu...	Canis lupus fam...
EDL39013	88.0	immunoglobulin ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB028953	6.9e-08	29.3	KIAA1030
AB018299	6e-07	25.7	KIAA0756
AB046788	4.1e-06	25.8	KIAA1568
D86983	9.5e-06	26.4	KIAA0230
AB032958	4.1e-05	23.7	KIAA1132

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013106	21	141	PF07686	Immunoglobulin V-set
	IPR013098	146	233	PF07679	Immunoglobulin I-set
	IPR013106	236	330	PF07686	Immunoglobulin V-set
	IPR013151	347	407	PF00047	Immunoglobulin
	IPR013151	443	498	PF00047	Immunoglobulin
	IPR003961	518	606	PF00041	Fibronectin
	IPR003961	634	718	PF00041	Fibronectin
HMMSmart	IPR003599	36	141	SM00409	Immunoglobulin subtype
	IPR003598	42	125	SM00408	Immunoglobulin subtype 2
	IPR003599	153	234	SM00409	Immunoglobulin subtype
	IPR003598	159	223	SM00408	Immunoglobulin subtype 2
	IPR003599	243	330	SM00409	Immunoglobulin subtype
	IPR003598	249	318	SM00408	Immunoglobulin subtype 2
	IPR003599	339	422	SM00409	Immunoglobulin subtype
	IPR003598	345	412	SM00408	Immunoglobulin subtype 2
	IPR003599	434	514	SM00409	Immunoglobulin subtype
	IPR003598	441	503	SM00408	Immunoglobulin subtype 2
	IPR003961	518	603	SM00060	Fibronectin
	IPR003961	634	713	SM00060	Fibronectin
ProfileScan	IPR007110	34	120	PS50835	Immunoglobulin-like
	IPR007110	146	226	PS50835	Immunoglobulin-like
	IPR007110	236	328	PS50835	Immunoglobulin-like
	IPR007110	332	420	PS50835	Immunoglobulin-like
	IPR007110	428	512	PS50835	Immunoglobulin-like
	IPR003961	518	614	PS50853	Fibronectin
	IPR003961	633	724	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	7	ASWAMVWCLGLAVLSLVISQGAD	29	PRIMARY	23
	2	64	VIEWLRFGFLLPIFIQFGLYSPR	86	PRIMARY	23
	3	743	QPVLAGVVGGVCFLGVAVLVSIL	765	PRIMARY	23

Primer_f	AATGTGAGGCTGTGAAAAGGC
Primer_r	ACATTCCATACCAAGGTGACC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AATGTGAGGCTGTGAAAAGGC
Primer_r	ACATTCCATACCAAGGTGACC
PCR product length	151 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles