Order Kazusa clone(s) from : ![]() |
Product ID | ORK00259 |
---|---|
Accession No | AB046845 |
Description | SMAD specific E3 ubiquitin protein ligase 1, transcript variant 1 |
Clone name | hh15184 |
Vector information | |
cDNA sequence | DNA sequence (5725 bp) Predicted protein sequence (859 aa) |
Flexi ORF Clone | FXC00259 |
Source | Human adult brain |
Rouge ID |
mKIAA1625
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3143 bp |
---|---|
Genome contig ID | gi89161213r_98363000 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | r | 98463000 | 98579659 | 19 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR000008 | 117 | 201 | PF00168 | C2 calcium-dependent membrane targeting |
IPR001202 | 338 | 367 | PF00397 | WW/Rsp5/WWP | |
IPR001202 | 410 | 439 | PF00397 | WW/Rsp5/WWP | |
IPR000569 | 551 | 859 | PF00632 | HECT | |
HMMSmart | IPR000008 | 116 | 219 | SM00239 | C2 calcium-dependent membrane targeting |
IPR001202 | 337 | 369 | SM00456 | WW/Rsp5/WWP | |
IPR001202 | 409 | 441 | SM00456 | WW/Rsp5/WWP | |
IPR000569 | 520 | 859 | SM00119 | HECT | |
ProfileScan | IPR000008 | 116 | 201 | PS50004 | C2 calcium-dependent membrane targeting |
IPR001202 | 336 | 369 | PS50020 | WW/Rsp5/WWP | |
IPR001202 | 408 | 441 | PS50020 | WW/Rsp5/WWP | |
IPR000569 | 522 | 859 | PS50237 | HECT | |
ScanRegExp | IPR001202 | 414 | 439 | PS01159 | WW/Rsp5/WWP |
![]() |
Primer_f | CCAGATAATGAAGATGCGACC |
---|---|
Primer_r | CTGGAAGAGCCCGTAATAAGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |