Order Kazusa clone(s) from : ![]() |
Product ID | ORK00833 |
---|---|
Accession No | AB037856 |
Description | WD repeat and FYVE domain containing 1 |
Clone name | hh13841 |
Vector information | |
cDNA sequence | DNA sequence (4574 bp) Predicted protein sequence (415 aa) |
Flexi ORF Clone |
FXC00833
![]() |
Source | Human adult brain |
Rouge ID |
mKIAA1435
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 3325 bp |
---|---|
Genome contig ID | gi89161199r_224348357 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99953 - 99904) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 224448310 | 224518261 | 12 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001680 | 199 | 233 | PD000018 | WD40 repeat |
FPrintScan | IPR001680 | 44 | 58 | PR00320 | WD40 repeat |
IPR001680 | 219 | 233 | PR00320 | WD40 repeat | |
IPR001680 | 386 | 400 | PR00320 | WD40 repeat | |
HMMPfam | IPR001680 | 19 | 57 | PF00400 | WD40 repeat |
IPR001680 | 109 | 143 | PF00400 | WD40 repeat | |
IPR001680 | 194 | 232 | PF00400 | WD40 repeat | |
IPR001680 | 237 | 275 | PF00400 | WD40 repeat | |
IPR000306 | 284 | 358 | PF01363 | Zinc finger | |
IPR001680 | 361 | 399 | PF00400 | WD40 repeat | |
HMMSmart | IPR001680 | 18 | 57 | SM00320 | WD40 repeat |
IPR001680 | 61 | 101 | SM00320 | WD40 repeat | |
IPR001680 | 108 | 147 | SM00320 | WD40 repeat | |
IPR001680 | 150 | 188 | SM00320 | WD40 repeat | |
IPR001680 | 193 | 232 | SM00320 | WD40 repeat | |
IPR001680 | 236 | 275 | SM00320 | WD40 repeat | |
IPR000306 | 281 | 358 | SM00064 | Zinc finger | |
IPR001680 | 360 | 399 | SM00320 | WD40 repeat | |
ProfileScan | IPR001680 | 25 | 56 | PS50082 | WD40 repeat |
IPR001680 | 25 | 284 | PS50294 | WD40 repeat | |
IPR001680 | 200 | 233 | PS50082 | WD40 repeat | |
IPR001680 | 243 | 284 | PS50082 | WD40 repeat | |
IPR000306 | 286 | 357 | PS50178 | Zinc finger | |
ScanRegExp | IPR001680 | 219 | 233 | PS00678 | WD40 repeat |
IPR001680 | 262 | 276 | PS00678 | WD40 repeat | |
IPR001680 | 386 | 400 | PS00678 | WD40 repeat |
![]() |
Primer_f | AAAGAAGTTAGTGACCCAGAG |
---|---|
Primer_r | ACAGGCTCCTCATTTCTTCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |