Order Kazusa clone(s) from : ![]() |
Product ID | ORK00546 |
---|---|
Accession No | AB007947 |
Description | zinc finger and BTB domain containing 40, transcript variant 2 |
Clone name | hh05955 |
Vector information | |
cDNA sequence | DNA sequence (6028 bp) Predicted protein sequence (1253 aa) |
Flexi ORF Clone | FXC00546 |
Source | Human adult brain |
Rouge ID |
mKIAA0478
by Kazusa Mouse cDNA Project
|
Note | We replaced hh00573, former representative clones for KIAA0478 with hh05955. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 2091 bp |
---|---|
Genome contig ID | gi89161185f_22550953 |
PolyA signal sequence (AATAAA,-23) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (176616 - 176665) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 22650947 | 22727567 | 18 | 99.4 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013069 | 28 | 131 | PF00651 | BTB/POZ |
IPR007087 | 821 | 844 | PF00096 | Zinc finger | |
IPR007087 | 850 | 872 | PF00096 | Zinc finger | |
IPR007087 | 878 | 901 | PF00096 | Zinc finger | |
IPR007087 | 907 | 929 | PF00096 | Zinc finger | |
IPR007087 | 935 | 958 | PF00096 | Zinc finger | |
IPR007087 | 992 | 1014 | PF00096 | Zinc finger | |
IPR007087 | 1020 | 1042 | PF00096 | Zinc finger | |
IPR007087 | 1118 | 1141 | PF00096 | Zinc finger | |
IPR007087 | 1149 | 1172 | PF00096 | Zinc finger | |
HMMSmart | IPR000210 | 38 | 131 | SM00225 | BTB/POZ-like |
IPR015880 | 750 | 770 | SM00355 | Zinc finger | |
IPR015880 | 780 | 803 | SM00355 | Zinc finger | |
IPR015880 | 821 | 844 | SM00355 | Zinc finger | |
IPR015880 | 850 | 872 | SM00355 | Zinc finger | |
IPR015880 | 878 | 901 | SM00355 | Zinc finger | |
IPR015880 | 907 | 929 | SM00355 | Zinc finger | |
IPR015880 | 935 | 958 | SM00355 | Zinc finger | |
IPR015880 | 964 | 987 | SM00355 | Zinc finger | |
IPR015880 | 992 | 1014 | SM00355 | Zinc finger | |
IPR015880 | 1020 | 1042 | SM00355 | Zinc finger | |
IPR015880 | 1060 | 1083 | SM00355 | Zinc finger | |
IPR015880 | 1089 | 1112 | SM00355 | Zinc finger | |
IPR015880 | 1118 | 1141 | SM00355 | Zinc finger | |
IPR015880 | 1149 | 1172 | SM00355 | Zinc finger | |
ProfileScan | IPR000210 | 38 | 101 | PS50097 | BTB/POZ-like |
IPR007087 | 821 | 849 | PS50157 | Zinc finger | |
IPR007087 | 850 | 877 | PS50157 | Zinc finger | |
IPR007087 | 878 | 906 | PS50157 | Zinc finger | |
IPR007087 | 907 | 934 | PS50157 | Zinc finger | |
IPR007087 | 935 | 963 | PS50157 | Zinc finger | |
IPR007087 | 964 | 992 | PS50157 | Zinc finger | |
IPR007087 | 992 | 1019 | PS50157 | Zinc finger | |
IPR007087 | 1020 | 1042 | PS50157 | Zinc finger | |
IPR007087 | 1060 | 1088 | PS50157 | Zinc finger | |
IPR007087 | 1089 | 1117 | PS50157 | Zinc finger | |
IPR007087 | 1149 | 1172 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 823 | 844 | PS00028 | Zinc finger |
IPR007087 | 852 | 872 | PS00028 | Zinc finger | |
IPR007087 | 880 | 901 | PS00028 | Zinc finger | |
IPR007087 | 909 | 929 | PS00028 | Zinc finger | |
IPR007087 | 937 | 958 | PS00028 | Zinc finger | |
IPR007087 | 966 | 987 | PS00028 | Zinc finger | |
IPR007087 | 994 | 1014 | PS00028 | Zinc finger | |
IPR007087 | 1022 | 1043 | PS00028 | Zinc finger | |
IPR007087 | 1062 | 1083 | PS00028 | Zinc finger | |
IPR007087 | 1091 | 1112 | PS00028 | Zinc finger | |
IPR007087 | 1120 | 1141 | PS00028 | Zinc finger | |
IPR007087 | 1151 | 1172 | PS00028 | Zinc finger |
Primer_f | |
---|---|
Primer_r | |
PCR conditions | °C![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCAAGCTGAACAAGAATATGG |
Primer_r | TGGGGACTACATTGCTGAAGG |
PCR product length | 186 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |