| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK00533 | 
|---|---|
| Accession No | AB007882 | 
| Description | adenylate cyclase 6 | 
| Clone name | hh01205s1 | 
| Vector information | |
| cDNA sequence | DNA sequence (5877 bp) Predicted protein sequence (1160 aa)  | 
| 
    
     
    HaloTag ORF Clone  | 
    
    
    
     
    FHC00533
     
     
     | 
| Flexi ORF Clone | FXC00533 | 
| Source | Human adult brain | 
| Rouge ID | 
    mKIAA0422
    
    by Kazusa Mouse cDNA Project
     | 
| Note | We replaced hh01205, former representative clones for KIAA0422 with hh01205s1. (2002/5/10) | 
 Length: 5877 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning | 
 Integrity of 3' end
    | Length of 3'UTR | 2393 bp | 
|---|---|
| Genome contig ID | gi89161190r_47346248 | 
| PolyA signal sequence (AATAAA,-20)  | 
            +----*----+----*----+----*----+----  | 
        
| Flanking genome sequence (100000 - 99951)  | 
            ----+----*----+----*----+----*----+----*----+----*  | 
        
  
 Ensembl ContigView  (Add our DAS server as a DAS source)
  
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
| 
 | 12 | r | 47446248 | 47469087 | 21 | 100.0 | Perfect prediction | 
 
        Length: 1160 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition | 
|---|---|---|---|---|---|
| HMMPfam | IPR001054 | 415 | 599 | PF00211 | Adenylyl cyclase class-3/4/guanylyl cyclase | 
| IPR009398 | 605 | 714 | PF06327 | Adenylate cyclase-like | |
| IPR001054 | 962 | 1156 | PF00211 | Adenylyl cyclase class-3/4/guanylyl cyclase | |
| HMMSmart | IPR001054 | 378 | 577 | SM00044 | Adenylyl cyclase class-3/4/guanylyl cyclase | 
| IPR001054 | 931 | 1139 | SM00044 | Adenylyl cyclase class-3/4/guanylyl cyclase | |
| ProfileScan | IPR001054 | 424 | 551 | PS50125 | Adenylyl cyclase class-3/4/guanylyl cyclase | 
| IPR001054 | 971 | 1110 | PS50125 | Adenylyl cyclase class-3/4/guanylyl cyclase | |
| ScanRegExp | IPR001054 | 528 | 551 | PS00452 | Adenylyl cyclase class-3/4/guanylyl cyclase | 
| IPR001054 | 1087 | 1110 | PS00452 | Adenylyl cyclase class-3/4/guanylyl cyclase | 
	Prediction of transmembrane (TM) segments| Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 195 | SSLTLLMAVLVLLTAVLLAFHA | 216 | PRIMARY | 22 | 2 | 226 | VALLACAAALFVGLMVVCNRHSF | 248 | PRIMARY | 23 | 3 | 253 | MWVVSYVVLGILAAVQVGGALAA | 275 | PRIMARY | 23 | 4 | 284 | LWCPVFFVYIAYTLLPIR | 301 | PRIMARY | 18 | 5 | 333 | QLGANVLLFLCTNVIGICTHYP | 354 | SECONDARY | 22 | 6 | 713 | RFGAYVACALLVFCFICFIQLLI | 735 | PRIMARY | 23 | 7 | 744 | GIYASIFLLLLITVLICAVYSCG | 766 | PRIMARY | 23 | 8 | 794 | SVLLVFTSAIANMYFIGNMLLSL | 816 | PRIMARY | 23 | 9 | 832 | AMIFVLGLIYLVLLLLGPPATIF | 854 | PRIMARY | 23 | 10 | 886 | LKYMTPVILLVFALALYLHAQQV | 908 | PRIMARY | 23 | 
|---|
           
	  RT-PCR
	   | 
	  
	  
|---|
 Experimental conditions| Primer_f | ATGGGGTAGGGGTGAGGGTAT | 
|---|---|
| Primer_r | GGGTGAGGAAAGGGACAATGG | 
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]()  | 
 Chromosome No. 12
 Experimental conditions| Panel name | GeneBridge 4 | 
|---|---|
| Primer_f | CAACTGGGTGAGGAAAGGGAC | 
| Primer_r | TGCTTCTTGCCAGGTGGGAGG | 
| PCR product length | 159 bp | 
| PCR conditions | 95 °C 15 sec 68 °C 60 sec 30 cycles |