|
Order Kazusa clone(s) from : |
| Product ID | ORK05840 |
|---|---|
| Accession No | AB007890 |
| Description | KIAA0430 |
| Clone name | hg02974 |
| Vector information | |
| cDNA sequence | DNA sequence (6827 bp) Predicted protein sequence (1506 aa) |
| Source | Human adult brain |
| Rouge ID |
mKIAA0430
by Kazusa Mouse cDNA Project
|
| Note | We replaced hh01734, former representative clones for KIAA0430 with hg02974. (2005/08/06) |
Length: 6827 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Integrity of 3' end
| Length of 3'UTR | 2305 bp |
|---|---|
| Genome contig ID | gi51511732r_15495746 |
| PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
| Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
| Chr | f/r | start | end | exon | identity | class | |
|---|---|---|---|---|---|---|---|
|
| 16 | r | 15595746 | 15637137 | 25 | 100.0 | Perfect prediction |
Length: 1506 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
RT-PCR
|
|---|
Experimental conditions| Primer_f | TCCCAACACACAAAACAGCAC |
|---|---|
| Primer_r | CACTGTTTGTTTTGGATTGGG |
| PCR conditions | 95 °C 30 sec 55 °C 30 sec 72 °C 60 sec 30 cycles![]() |
Chromosome No. 16
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | TCCCAACACACAAAACAGCAC |
| Primer_r | CACTGTTTGTTTTGGATTGGG |
| PCR product length | 106 bp |
| PCR conditions | 95 °C 15 sec 62 °C 60 sec 30 cycles |