KIAA0524

Product ID	ORK06729
Accession No	AB011096
Description	sterile alpha and TIR motif containing 1
Clone name	hg01923
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6559 bp) Predicted protein sequence (598 aa)
Source	Human adult brain
Rouge ID	mKIAA0524 by Kazusa Mouse cDNA Project

Length: 6559 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4761 bp
Genome contig ID	gi51511734f_23623556
PolyA signal sequence (CATAAA,-20)	+--------+--------+----*----+---- TGACAGAACCCAGCACATAAAAGAAAAAAAAAAGT
Flanking genome sequence (128638 - 128687)	----+--------+--------+--------+--------+----* ACATGTGATATTGTCTGATGAAAGCTTGATGGAAATGGCTTTTTTCTGGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	23723556	23752192	9	99.1	Perfect prediction

Length: 598 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH40429	100.0	SARM1 protein [...	Homo sapiens
Q6SZW1	100.0	Sterile alpha a...	Homo sapiens
AAI22861	98.6	SARM1 protein [...	Homo sapiens
XP_001504177	96.2	sterile alpha a...	Equus caballus
XP_548285	96.3	similar to ster...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033056	8.9e-06	24.6	KIAA1230

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011510	283	350	PF07647	Sterile alpha motif homology 2
HMMPfam	IPR011510	353	422	PF07647	Sterile alpha motif homology 2
HMMSmart	IPR001660	283	350	SM00454	Sterile alpha motif SAM
	IPR001660	353	422	SM00454	Sterile alpha motif SAM
	IPR000157	435	576	SM00255	Toll-Interleukin receptor
ProfileScan	IPR001660	286	350	PS50105	Sterile alpha motif SAM
ProfileScan	IPR001660	360	422	PS50105	Sterile alpha motif SAM

Primer_f	GCAGCCATTTGTTTAGTAGCC
Primer_r	TCACTTAACCTATGTCTCCCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GCAGCCATTTGTTTAGTAGCC
Primer_r	TCACTTAACCTATGTCTCCCC
PCR product length	125 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles