Order Kazusa clone(s) from : ![]() |
Product ID | ORK00511 |
---|---|
Accession No | AB002344 |
Description | lysine (K)-specific demethylase 6B |
Clone name | hg01508s1 |
Vector information | |
cDNA sequence | DNA sequence (6698 bp) Predicted protein sequence (1682 aa) |
HaloTag ORF Clone |
FHC00511
![]() |
Flexi ORF Clone | FXC00511 |
Source | Human adult brain |
Rouge ID |
mKIAA0346
by Kazusa Mouse cDNA Project
|
Note | We replaced hg01508, former representative clones for KIAA0346 with hg01508s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1268 bp |
---|---|
Genome contig ID | gi51511734f_7583967 |
PolyA signal sequence (AATAAA,-11) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (114866 - 114915) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | f | 7683953 | 7698831 | 22 | 99.5 | Terminal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013129 | 1377 | 1485 | PF02373 | Transcription factor jumonji |
HMMSmart | IPR003347 | 1339 | 1502 | SM00558 | Transcription factor jumonji/aspartyl beta-hydroxylase |
ProfileScan | IPR003347 | 1339 | 1502 | PS51184 | Transcription factor jumonji/aspartyl beta-hydroxylase |
![]() |
---|
Primer_f | CGAAAATAGGGGTAGGGTTGG |
---|---|
Primer_r | TTCTCTGGGGCTTTATTTTCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CGAAAATAGGGGTAGGGTTGG |
Primer_r | TTCTCTGGGGCTTTATTTTCG |
PCR product length | 151 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |