|
Order Kazusa clone(s) from : |
| Product ID | ORK01976 |
|---|---|
| Accession No | AB007930 |
| Description | pogo transposable element with ZNF domain |
| Clone name | hg00867 |
| Vector information | |
| cDNA sequence | DNA sequence (6148 bp) Predicted protein sequence (1355 aa) |
|
HaloTag ORF Clone |
FHC01976
|
| Flexi ORF Clone | FXC01976 |
| Source | Human adult brain |
| Rouge ID |
mKIAA0461
by Kazusa Mouse cDNA Project
|
Length: 6148 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).
| N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning |
Length: 1355 aa
Result of homology search against nr database
(FASTA output,
Multiple alignment)![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database
(FASTA output,
Multiple alignment)The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)
Result of InterProScan
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR007087 | 439 | 461 | PF00096 | Zinc finger |
| IPR007087 | 564 | 586 | PF00096 | Zinc finger | |
| IPR015175 | 961 | 1024 | PF09091 | Centromere protein B | |
| IPR004875 | 1062 | 1218 | PF03184 | CENP-B protein | |
| HMMSmart | IPR015880 | 439 | 461 | SM00355 | Zinc finger |
| IPR015880 | 475 | 498 | SM00355 | Zinc finger | |
| IPR015880 | 505 | 528 | SM00355 | Zinc finger | |
| IPR015880 | 535 | 558 | SM00355 | Zinc finger | |
| IPR015880 | 564 | 586 | SM00355 | Zinc finger | |
| IPR015880 | 592 | 614 | SM00355 | Zinc finger | |
| IPR015880 | 716 | 739 | SM00355 | Zinc finger | |
| IPR015880 | 760 | 785 | SM00355 | Zinc finger | |
| IPR006600 | 966 | 1030 | SM00674 | Centromere protein B | |
| ProfileScan | IPR007087 | 439 | 466 | PS50157 | Zinc finger |
| IPR007087 | 475 | 503 | PS50157 | Zinc finger | |
| IPR006600 | 960 | 1030 | PS51253 | Centromere protein B | |
| ScanRegExp | IPR007087 | 441 | 461 | PS00028 | Zinc finger |
| IPR007087 | 477 | 498 | PS00028 | Zinc finger | |
| IPR007087 | 507 | 528 | PS00028 | Zinc finger | |
| IPR007087 | 566 | 586 | PS00028 | Zinc finger | |
| IPR007087 | 594 | 615 | PS00028 | Zinc finger |
Experimental conditions| Primer_f | |
|---|---|
| Primer_r | |
| PCR conditions | °C sec °C sec cycles![]() |
Chromosome No. 1
Experimental conditions| Panel name | GeneBridge 4 |
|---|---|
| Primer_f | TCTACTACTAAGCCATGCAGG |
| Primer_r | AGCTGGGGTTCCTGTCTTCTG |
| PCR product length | 138 bp |
| PCR conditions | 95 °C 15 sec 68 °C 60 sec 30 cycles |