KIAA0311

Product ID	ORK00049
Accession No	AB002309
Description	A kinase (PRKA) anchor protein 6
Clone name	hg00112s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (10327 bp) Predicted protein sequence (2324 aa)
HaloTag ORF Clone	FHC00049
Flexi ORF Clone	FXC00049
Source	Human adult brain
Rouge ID	mKIAA0311 by Kazusa Mouse cDNA Project
Note	We replaced hg00112, former representative clones for KIAA0311 with hg00112s1. (2002/5/10)

Length: 10327 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3257 bp
Genome contig ID	gi51511730f_31768290
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- ATTGTAAATTTCAAACAATAAATAAATAAGAATCC
Flanking genome sequence (603730 - 603779)	----+--------+--------+--------+--------+----* ATGACTTCCTTCAGTGGCCCAGTCCAGTGCCTAAGTCATCTGGAATCTTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	14	f	31868290	32372018	14	99.7	Perfect prediction

Length: 2324 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q13023	100.0	A-kinase anchor...	Homo sapiens
AAI37233	99.9	A kinase (PRKA)...	Homo sapiens
AAA92354	99.9	A-kinase anchor...	Homo sapiens
XP_509893	99.1	A-kinase anchor...	Pan troglodytes
XP_001115172	97.4	similar to A-ki...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011154	5.5e-06	23.0	KIAA0582

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR002017	787	888	SM00150	Spectrin repeat
	IPR002017	967	1065	SM00150	Spectrin repeat
	IPR002017	1086	1194	SM00150	Spectrin repeat
ScanRegExp	IPR002173	2206	2219	PS00584	Carbohydrate kinase

Primer_f	TCAGTCAGGTTGGAATGGATC
Primer_r	CTCTTTCTCATGGCAACCCTG
PCR conditions	95 °C30 sec61 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TCAGTCAGGTTGGAATGGATC
Primer_r	CTCTTTCTCATGGCAACCCTG
PCR product length	118 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles