Order Kazusa clone(s) from : ![]() |
Product ID | ORK00961 |
---|---|
Accession No | AB075850 |
Description | glutamyl-tRNA synthetase 2, mitochondrial, transcript variant 1 |
Clone name | fk07936 |
Vector information | |
cDNA sequence | DNA sequence (3110 bp) Predicted protein sequence (519 aa) |
HaloTag ORF Clone |
FHC00961
![]() |
Flexi ORF Clone | FXC00961 |
Source | Human fetal brain |
Rouge ID |
mKIAA1970
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 16 | r | 23441551 | 23476154 | 10 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000924 | 36 | 48 | PR00987 | Glutamyl/glutaminyl-tRNA synthetase |
IPR000924 | 50 | 61 | PR00987 | Glutamyl/glutaminyl-tRNA synthetase | |
IPR000924 | 65 | 78 | PR00987 | Glutamyl/glutaminyl-tRNA synthetase | |
IPR000924 | 222 | 232 | PR00987 | Glutamyl/glutaminyl-tRNA synthetase | |
IPR000924 | 238 | 246 | PR00987 | Glutamyl/glutaminyl-tRNA synthetase | |
HMMPfam | IPR000924 | 32 | 349 | PF00749 | Glutamyl/glutaminyl-tRNA synthetase |
HMMTigr | IPR004527 | 32 | 519 | TIGR00464 | Glutamyl-tRNA synthetase |
ScanRegExp | IPR001412 | 39 | 50 | PS00178 | Aminoacyl-tRNA synthetase |
![]() |
Primer_f | GTGGAAACAATCTCTGACTGC |
---|---|
Primer_r | AATGTGTGAGAAACCAGACCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |