KIAA1953

Product ID	ORK05551
Accession No	AB075833
Description	inter-alpha-trypsin inhibitor heavy chain family, member 5
Clone name	fk00837
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3132 bp) Predicted protein sequence (824 aa)
Source	Human fetal brain
Rouge ID	mKIAA1953 by Kazusa Mouse cDNA Project

Length: 3132 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	656 bp
Genome contig ID	gi89161187r_7544395
PolyA signal sequence (ATTAAA,-27)	+--------+--------+----*----+---- TAGTTTTCATTAAAAAGAAATTTGATTGAAAATAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAACATCTACAGCTCAGATACTGATCTCTTTCTAATGGGCTTTGTAAACC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	10	r	7644395	7722770	11	99.7	Perfect prediction

Length: 824 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW86379	100.0	inter-alpha (gl...	Homo sapiens
Q86UX2	99.9	Inter-alpha-try...	Homo sapiens
AAO49812	99.8	inter-alpha try...	Homo sapiens
BAB55070	99.6	unnamed protein...	Homo sapiens
CAI12955	99.4	inter-alpha (gl...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002035	176	193	PR00453	von Willebrand factor
FPrintScan	IPR002035	282	290	PR00453	von Willebrand factor
HMMPfam	IPR013694	6	43	PF08487	Vault protein inter-alpha-trypsin
	IPR002035	177	360	PF00092	von Willebrand factor
	IPR010600	597	791	PF06668	Inter-alpha-trypsin inhibitor heavy chain
HMMSmart	IPR002035	175	358	SM00327	von Willebrand factor
ProfileScan	IPR002035	177	360	PS50234	von Willebrand factor

Primer_f	TTCCCCAACTACTTCAACGGC
Primer_r	CATCTTTCCCTGCCTTCTGAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-