ROUGE

Gene/Protein Characteristic Table for mKIAA1953

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK087428
Description :	inter-alpha (globulin) inhibitor H5. inter-alpha trypsin inhibitor heavy chain precursor 5.
Clone Name :	mek00815 [Vector Info]
Source :	Mouse embryonic intestinal tract

Features of the cloned DNA sequence	Description

Length: 942 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 193 bp

Genome contig ID gi66880554f_10061612
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTTCCCTTCCTGCCTTCCTCATCTATACTAGATG
Flanking genome sequence
(106175 - 106224)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAACAAACAAACAAACAAAAAAAAAACGGTAGCACCAAGAAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1953 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1953	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..749
Length: 248 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL08005	4.1e-109	100.0	inter-alpha (gl...	Mus musculus
Q8BJD1	4.2e-109	100.0	Inter-alpha-try...	Mus musculus
BAE24467	4.2e-109	100.0	unnamed protein...	Mus musculus
EDL78621	2.4e-95	89.5	rCG55860, isofo...	Rattus norvegicus
EDL78620	2.4e-95	89.5	rCG55860, isofo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR010600 11 205 PF06668 Inter-alpha-trypsin inhibitor heavy chain

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR010600	11	205	PF06668	Inter-alpha-trypsin inhibitor heavy chain

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	193 bp
Genome contig ID	gi66880554f_10061612
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTTCCCTTCCTGCCTTCCTCATCTATACTAGATG
Flanking genome sequence (106175 - 106224)	----+--------+--------+--------+--------+----* AAAAAAAAAAACAAACAAACAAACAAAAAAAAAACGGTAGCACCAAGAAG

Gene/Protein Characteristic Table for mKIAA1953

Features of the cloned DNA sequence

Features of the protein sequence