KIAA1484

Product ID	ORK05868
Accession No	AB040917
Description	leucine rich repeat and fibronectin type III domain containing 1
Clone name	fj06928
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3174 bp) Predicted protein sequence (700 aa)
Source	Human fetal brain

Length: 3174 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1069 bp
Genome contig ID	gi42406306r_44389048
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GGAATAATCACAAAAATAAAATGATCATAATAGCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACGCTTAGTGAATACTTACTTACTATGTGCCAAGCACTTAAGTCATTTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	44489048	44497605	2	99.4	Perfect prediction

Length: 700 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P244	100.0	Leucine-rich re...	Homo sapiens
XP_512991	99.7	similar to leuc...	Pan troglodytes
XP_001087094	97.1	similar to leuc...	Macaca mulatta
Q2WF71	95.3	Leucine-rich re...	Mus musculus
AAZ20639	95.2	SALM2 [Mus musc...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033072	2.8e-47	47.8	KIAA1246
D86983	3.4e-09	31.8	KIAA0230
AB040902	1.8e-05	24.1	KIAA1469
AB020725	3.2e-05	30.3	KIAA0918
AB018349	8.7e-05	25.7	KIAA0806

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	93	106	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	138	151	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	19	41	PF00560	Leucine-rich repeat
	IPR001611	43	65	PF00560	Leucine-rich repeat
	IPR001611	67	89	PF00560	Leucine-rich repeat
	IPR001611	92	114	PF00560	Leucine-rich repeat
	IPR001611	116	138	PF00560	Leucine-rich repeat
	IPR013098	228	316	PF07679	Immunoglobulin I-set
	IPR003961	355	431	PF00041	Fibronectin
HMMSmart	IPR003591	17	40	SM00369	Leucine-rich repeat
	IPR003591	41	64	SM00369	Leucine-rich repeat
	IPR003591	65	88	SM00369	Leucine-rich repeat
	IPR003591	90	113	SM00369	Leucine-rich repeat
	IPR003591	114	137	SM00369	Leucine-rich repeat
	IPR003591	138	162	SM00369	Leucine-rich repeat
	IPR000483	181	226	SM00082	Cysteine-rich flanking region
	IPR003599	235	317	SM00409	Immunoglobulin subtype
	IPR003598	241	306	SM00408	Immunoglobulin subtype 2
	IPR003961	351	431	SM00060	Fibronectin
ProfileScan	IPR007110	228	315	PS50835	Immunoglobulin-like
ProfileScan	IPR003961	350	441	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	464	TMIIAIGGVIVASVLVFIVLLMI	486	PRIMARY	23

Primer_f	CAGACCAGGTGCCAACGATTC
Primer_r	CGAGGGAGTCATCAACGGAAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	CAGACCAGGTGCCAACGATTC
Primer_r	CGAGGGAGTCATCAACGGAAC
PCR product length	155 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles