KIAA1883

Product ID	ORK00294
Accession No	AB067470
Description	lemur tyrosine kinase 3
Clone name	fh02249
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4943 bp) Predicted protein sequence (1480 aa)
Flexi ORF Clone	FXC00294
Source	Human fetal brain

Length: 4943 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	500 bp
Genome contig ID	gi42406306r_53580342
PolyA signal sequence (None)	+--------+--------+----*----+---- ATTATTTAAAAAAGACAAAAACAACCTTTTGGAGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACACGGGGCCTGTGCGTATTTCGCGAGGTGAGGAGGGGAGGATGCAGGG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	19	r	53680342	53708231	16	99.9	Perfect prediction

Length: 1480 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_001073903	100.0	lemur tyrosine ...	Homo sapiens
Q96Q04	100.0	Serine/threonin...	Homo sapiens
EAW52353	99.9	hCG1811754 [Hom...	Homo sapiens
XP_001789580	93.0	similar to Seri...	Bos taurus
BAF64834	88.2	apoptosis-assoc...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014541	1.1e-26	35.5	KIAA0641
AB029002	7.6e-26	30.6	KIAA1079

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	156	426	PD000001	Protein kinase
FPrintScan	IPR001245	230	243	PR00109	Tyrosine protein kinase
	IPR001245	276	294	PR00109	Tyrosine protein kinase
	IPR001245	351	373	PR00109	Tyrosine protein kinase
HMMPfam	IPR001245	153	428	PF07714	Tyrosine protein kinase
HMMSmart	IPR001245	153	428	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	153	1371	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	153	431	PS50011	Protein kinase
ScanRegExp	IPR000719	159	184	PS00107	Protein kinase
ScanRegExp	IPR008266	282	294	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	21	MPAPGALILLAAVSASGCLASPA	43	SECONDARY	23
SOSUI2	2	57	PPYAVVLISCSGLLAFIFLLLTC	79	PRIMARY	23

Primer_f	TGCTGATTATGGAGTTCTGTC
Primer_r	ACGTAGTTGTGGGAATGCAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-