KIAA1079

Product ID	ORK00174
Accession No	AB029002
Description	lemur tyrosine kinase 2
Clone name	hj06972
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4954 bp) Predicted protein sequence (1476 aa)
HaloTag ORF Clone	FHC00174
Flexi ORF Clone	FXC00174
Source	Human adult brain
Rouge ID	mKIAA1079 by Kazusa Mouse cDNA Project

Length: 4954 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	296 bp
Genome contig ID	gi89161213f_97474133
PolyA signal sequence (None)	+--------+--------+----*----+---- CGGCGTCCCTCAGTGCCCCGTGCACCCGCGGCCGC
Flanking genome sequence (198852 - 198901)	----+--------+--------+--------+--------+----* GGCCTCCCAGGCAGTGCTCATGCGCTGGCCGTCGGGGGAGGCAGGGGCAC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	f	97574133	97672983	15	99.4	Perfect prediction

Length: 1476 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10414	100.0	serine/threonin...	synthetic construct
EAW76720	99.9	lemur tyrosine ...	Homo sapiens
Q8IWU2	99.7	Serine/threonin...	Homo sapiens
AAN08717	99.7	KPI-2 protein [...	Homo sapiens
XP_001134909	99.0	lemur tyrosine ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067470	2.7e-54	30.5	KIAA1883
AB014541	9.9e-44	34.2	KIAA0641
AB040892	9.9e-07	28.9	KIAA1459

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	162	423	PD000001	Protein kinase
FPrintScan	IPR001245	236	249	PR00109	Tyrosine protein kinase
	IPR001245	277	295	PR00109	Tyrosine protein kinase
	IPR001245	352	374	PR00109	Tyrosine protein kinase
HMMPfam	IPR001245	159	429	PF07714	Tyrosine protein kinase
HMMSmart	IPR001245	159	429	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	159	432	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	159	429	PS50011	Protein kinase
ScanRegExp	IPR000719	165	190	PS00107	Protein kinase
ScanRegExp	IPR008266	283	295	PS00109	Tyrosine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	32	RLLLLLLVLLIAGSAGAAPLP	52	PRIMARY	21
SOSUI2	2	68	SFVILCVCSLIILIVLIANCVSC	90	PRIMARY	23

Primer_f	GAACGAACTCCTTGCCTACAC
Primer_r	TGAGGCTATGCAGGTTGAAGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	TTGCCAGCTTTTCCCTCACAC
Primer_r	TCTTCCTCCCAATCTCATGTC
PCR product length	198 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles