Order Kazusa clone(s) from : ![]() |
Product ID | ORK00969 |
---|---|
Accession No | AB095926 |
Description | sterile alpha motif domain containing 9-like, transcript variant 1 |
Clone name | eg01633 |
Vector information | |
cDNA sequence | DNA sequence (7122 bp) Predicted protein sequence (1587 aa) |
HaloTag ORF Clone |
FHC00969
![]() |
Flexi ORF Clone | FXC00969 |
Source | |
Rouge ID |
mKIAA2005
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1162 bp |
---|---|
Genome contig ID | gi89161213r_92497304 |
PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | r | 92597304 | 92615605 | 5 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
ProfileScan | IPR001660 | 17 | 63 | PS50105 | Sterile alpha motif SAM |
![]() |
Primer_f | GAGAGATAAAGTGTACCTGTC |
---|---|
Primer_r | ATAGACTGGACTGCTGCTGAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |