Gene/Protein Characteristic Table for KIAA1905
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK06735
Accession No AB067492
Description scinderin
Clone name ag00008
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (2570 bp)
Predicted protein sequence (626 aa)
Source Human brain (amygdala)
Rouge ID mKIAA1905 by Kazusa Mouse cDNA Project
Features of the cloned cDNA sequence
Description

Length: 2570 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 7 f 12576728 12659254 15 99.8 Perfect prediction
Features of the protein sequence
Description

Length: 626 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EAW93648 0 100.0 scinderin, isof...
Homo sapiens
AAD15423 0 100.0 similar to mous...
Homo sapiens
Q9Y6U3 0 100.0 Adseverin; Scin...
Homo sapiens
BAC11416 0 99.8 unnamed protein...
Homo sapiens
AAK60494 0 99.8 scinderin [Homo...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR007122 372 393 PR00597 Gelsolin
IPR007122 461 477 PR00597 Gelsolin
IPR007122 482 500 PR00597 Gelsolin
IPR007122 515 535 PR00597 Gelsolin
HMMPfam IPR007123 72 154 PF00626 Gelsolin region
IPR007123 192 267 PF00626 Gelsolin region
IPR007123 309 387 PF00626 Gelsolin region
IPR007123 451 529 PF00626 Gelsolin region
HMMSmart IPR007122 63 160 SM00262 Gelsolin
IPR007122 181 273 SM00262 Gelsolin
IPR007122 298 393 SM00262 Gelsolin
IPR007122 442 535 SM00262 Gelsolin
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CTGGAGGATTGAGAAGCTGGA
Primer_r AAGTGCAGGTGGTAGGTGAAG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 7
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp