ROUGE

Gene/Protein Characteristic Table for mKIAA1905

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173295
Description :	Adseverin.
Clone Name :	mnh07319 [Vector Info]
Source :	Mouse NKT cells

Features of the cloned DNA sequence	Description

Length: 2965 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 735 bp

Genome contig ID gi65532617r_36558511
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
ATGATGTTTTTCATAATTAAAATATATCCTTTTGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAATGTCTTGTATTGTAACTTTTTAGCCAAATTTGATGGGTTAATTTTA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1905 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1905	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2230
Length: 742 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH63328	100.0	Scin protein [M...	Mus musculus
Q60604	99.7	Adseverin; Scin...	Mus musculus
AAP85593	97.8	Scinderin [Ratt...	Rattus norvegicus
AAH21090	91.6	SCIN protein [H...	Homo sapiens
XP_527671	91.5	scinderin isofo...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR007122 353 374 PR00597 Gelsolin

IPR007122 442 458 PR00597 Gelsolin

IPR007122 463 481 PR00597 Gelsolin

IPR007122 496 516 PR00597 Gelsolin

IPR007122 550 570 PR00597 Gelsolin

IPR007122 609 628 PR00597 Gelsolin

IPR007122 664 686 PR00597 Gelsolin

IPR007122 693 712 PR00597 Gelsolin

HMMPfam IPR007123 53 135 PF00626 Gelsolin region

IPR007123 173 248 PF00626 Gelsolin region

IPR007123 290 368 PF00626 Gelsolin region

IPR007123 432 510 PF00626 Gelsolin region

IPR007123 548 617 PF00626 Gelsolin region

IPR007123 653 731 PF00626 Gelsolin region

HMMSmart IPR007122 44 141 SM00262 Gelsolin

IPR007122 162 254 SM00262 Gelsolin

IPR007122 279 374 SM00262 Gelsolin

IPR007122 423 516 SM00262 Gelsolin

IPR007122 537 623 SM00262 Gelsolin

IPR007122 642 737 SM00262 Gelsolin

ProfileScan IPR007122 54 103 PS50091 Gelsolin

IPR007122 175 215 PS50091 Gelsolin

IPR007122 288 334 PS50091 Gelsolin

IPR007122 425 478 PS50091 Gelsolin

IPR007122 550 591 PS50091 Gelsolin

IPR007122 653 695 PS50091 Gelsolin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR007122	353	374	PR00597	Gelsolin
IPR007122	442	458	PR00597	Gelsolin
IPR007122	463	481	PR00597	Gelsolin
IPR007122	496	516	PR00597	Gelsolin
IPR007122	550	570	PR00597	Gelsolin
IPR007122	609	628	PR00597	Gelsolin
IPR007122	664	686	PR00597	Gelsolin
IPR007122	693	712	PR00597	Gelsolin
HMMPfam	IPR007123	53	135	PF00626	Gelsolin region
IPR007123	173	248	PF00626	Gelsolin region
IPR007123	290	368	PF00626	Gelsolin region
IPR007123	432	510	PF00626	Gelsolin region
IPR007123	548	617	PF00626	Gelsolin region
IPR007123	653	731	PF00626	Gelsolin region
HMMSmart	IPR007122	44	141	SM00262	Gelsolin
IPR007122	162	254	SM00262	Gelsolin
IPR007122	279	374	SM00262	Gelsolin
IPR007122	423	516	SM00262	Gelsolin
IPR007122	537	623	SM00262	Gelsolin
IPR007122	642	737	SM00262	Gelsolin
ProfileScan	IPR007122	54	103	PS50091	Gelsolin
IPR007122	175	215	PS50091	Gelsolin
IPR007122	288	334	PS50091	Gelsolin
IPR007122	425	478	PS50091	Gelsolin
IPR007122	550	591	PS50091	Gelsolin
IPR007122	653	695	PS50091	Gelsolin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	735 bp
Genome contig ID	gi65532617r_36558511
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- ATGATGTTTTTCATAATTAAAATATATCCTTTTGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAATGTCTTGTATTGTAACTTTTTAGCCAAATTTGATGGGTTAATTTTA

Gene/Protein Characteristic Table for mKIAA1905

Features of the cloned DNA sequence

Features of the protein sequence