Order Kazusa clone(s) from : ![]() |
Product ID | ORK06821 |
---|---|
Accession No | AB075865 |
Description | SH3 domain and tetratricopeptide repeats 2 |
Clone name | pf00647 |
Vector information | |
cDNA sequence | DNA sequence (7327 bp) Predicted protein sequence (955 aa) |
Source | Human brain (hippocampus) |
Rouge ID |
mKIAA1985
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | Warning |
Length of 3'UTR | 3366 bp |
---|---|
Genome contig ID | gi51511721r_148261104 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | r | 148361104 | 148422800 | 18 | 99.2 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR001440 | 503 | 536 | PF00515 | Tetratricopeptide TPR_1 |
IPR001440 | 833 | 866 | PF00515 | Tetratricopeptide TPR_1 | |
HMMSmart | IPR013026 | 195 | 228 | SM00028 | Tetratricopeptide region |
IPR013026 | 503 | 536 | SM00028 | Tetratricopeptide region | |
IPR013026 | 711 | 744 | SM00028 | Tetratricopeptide region | |
IPR013026 | 833 | 866 | SM00028 | Tetratricopeptide region |
![]() |
Primer_f | TTGAATCCATCCAGAATCCTC |
---|---|
Primer_r | TTAGGTCCATGAGCAGTTCCG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |