Order Kazusa clone(s) from : ![]() |
Product ID | ORK05740 |
---|---|
Accession No | AB075859 |
Description | Homo sapiens mRNA for KIAA1979 protein. |
Clone name | fj09511 |
Vector information | |
cDNA sequence | DNA sequence (5053 bp) Predicted protein sequence (309 aa) |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | Warning |
Length of 3'UTR | 3652 bp |
---|---|
Genome contig ID | gi42406306f_58476614 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (105046 - 105095) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 19 | f | 58576614 | 58581658 | 1 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 15 | 38 | PD000003 | Zinc finger |
IPR007087 | 43 | 66 | PD000003 | Zinc finger | |
IPR007087 | 71 | 94 | PD000003 | Zinc finger | |
IPR007087 | 99 | 121 | PD000003 | Zinc finger | |
IPR007087 | 127 | 150 | PD000003 | Zinc finger | |
HMMPfam | IPR007087 | 15 | 37 | PF00096 | Zinc finger |
IPR007087 | 43 | 65 | PF00096 | Zinc finger | |
IPR007087 | 71 | 93 | PF00096 | Zinc finger | |
IPR007087 | 99 | 121 | PF00096 | Zinc finger | |
HMMSmart | IPR015880 | 15 | 37 | SM00355 | Zinc finger |
IPR015880 | 43 | 65 | SM00355 | Zinc finger | |
IPR015880 | 71 | 93 | SM00355 | Zinc finger | |
IPR015880 | 99 | 121 | SM00355 | Zinc finger | |
IPR015880 | 127 | 149 | SM00355 | Zinc finger | |
ProfileScan | IPR007087 | 15 | 42 | PS50157 | Zinc finger |
IPR007087 | 43 | 70 | PS50157 | Zinc finger | |
IPR007087 | 71 | 98 | PS50157 | Zinc finger | |
IPR007087 | 99 | 126 | PS50157 | Zinc finger | |
IPR007087 | 127 | 154 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 17 | 37 | PS00028 | Zinc finger |
IPR007087 | 45 | 65 | PS00028 | Zinc finger | |
IPR007087 | 73 | 93 | PS00028 | Zinc finger | |
IPR007087 | 101 | 121 | PS00028 | Zinc finger |
![]() |
Primer_f | CTTCTTGCCACATCTTCTCAG |
---|---|
Primer_r | GGTAACGTGATTGTGATGCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |