KIAA1910

Product ID	ORK00297
Accession No	AB067497
Description	SLIT and NTRK-like family, member 1, transcript variant 1
Clone name	fh21867
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5187 bp) Predicted protein sequence (760 aa)
HaloTag ORF Clone	FHC00297
Flexi ORF Clone	FXC00297
Source	Human fetal brain
Rouge ID	mKIAA1910 by Kazusa Mouse cDNA Project

Length: 5187 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2211 bp
Genome contig ID	gi51511729r_83249342
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- ACACTTTTTTAATAAAATCTTTATTATAAACCATG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTATTCCTAAGGCCATTCATCATTTTCTCTCTTGATTCTTTTGTTTGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	13	r	83349342	83354529	1	99.0	Perfect prediction

Length: 760 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96PX8	100.0	SLIT and NTRK-l...	Homo sapiens
AAH51738	99.9	SLIT and NTRK-l...	Homo sapiens
XP_001143864	99.9	slit and trk li...	Pan troglodytes
XP_001093240	99.7	similar to slit...	Macaca mulatta
BAG61443	99.7	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058757	3e-71	46.5	KIAA1854
AB020725	6.7e-38	41.2	KIAA0918
AB020655	8.5e-34	38.8	KIAA0848
AB011538	2.4e-12	23.7	KIAA0814
AB011537	5.1e-11	24.5	KIAA0813

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	243	256	PR00019	Leucine-rich repeat
FPrintScan	IPR001611	510	523	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	123	145	PF00560	Leucine-rich repeat
	IPR001611	195	217	PF00560	Leucine-rich repeat
	IPR001611	219	241	PF00560	Leucine-rich repeat
	IPR001611	440	462	PF00560	Leucine-rich repeat
	IPR001611	464	486	PF00560	Leucine-rich repeat
	IPR001611	488	510	PF00560	Leucine-rich repeat
	IPR001611	512	534	PF00560	Leucine-rich repeat
	IPR001611	536	558	PF00560	Leucine-rich repeat
HMMSmart	IPR003591	145	168	SM00369	Leucine-rich repeat
	IPR003591	169	192	SM00369	Leucine-rich repeat
	IPR003591	193	216	SM00369	Leucine-rich repeat
	IPR003591	217	240	SM00369	Leucine-rich repeat
	IPR003591	244	264	SM00369	Leucine-rich repeat
	IPR000483	276	326	SM00082	Cysteine-rich flanking region
	IPR003591	438	461	SM00369	Leucine-rich repeat
	IPR003591	462	485	SM00369	Leucine-rich repeat
	IPR003591	486	509	SM00369	Leucine-rich repeat
	IPR003591	510	533	SM00369	Leucine-rich repeat
	IPR003591	534	557	SM00369	Leucine-rich repeat
	IPR003591	558	581	SM00369	Leucine-rich repeat
	IPR000483	593	643	SM00082	Cysteine-rich flanking region

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	61	LALKMLLWILLLETSLCFAAGNV	83	PRIMARY	23
SOSUI2	2	681	ISVLVPGLLLVFVTSAFTVVGML	703	PRIMARY	23

Primer_f	GAGCTTTTCCTACGAGATAAC
Primer_r	TCCAGGTAATTGCTATCCATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-