Gene/Protein Characteristic Table for KIAA1780
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00915
Accession No AB058676
Description multiple EGF-like-domains 10, transcript variant 1
Clone name pf01012
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (7522 bp)
Predicted protein sequence (1192 aa)
Flexi ORF Clone FXC00915
Source Human brain (hippocampus)
Features of the cloned cDNA sequence
Description

Length: 7522 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning Warning
Integrity of 3' end
Length of 3'UTR 3896 bp
Genome contig ID gi51511721f_126554514
PolyA signal sequence
(AATAAA,-15)		 
+----*----+----*----+----*----+----
ATGAGTTTATAGATTAATGCAATAAACTTTCTAAT
Flanking genome sequence
(270295 - 270344)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAACTCTAGTGTTTCTTTCTATATCTGATTCTACTGTTGATTAATGA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 5 f 126654514 126824807 26 99.4 Perfect prediction
Features of the protein sequence
Description

Length: 1192 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAB47409 0 100.0 MEGF10 protein ...
 Homo sapiens
Q96KG7 0 100.0 Multiple epider...
 Homo sapiens
CAH18275 0 99.9 hypothetical pr...
 Homo sapiens
XP_517907 0 99.3 MEGF10 protein ...
 Pan troglodytes
XP_001097941 0 99.1 similar to MEGF...
 Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB058677 5.1e-200 58.9 KIAA1781
AB011539 3.4e-94 42.5 KIAA0815
D63483 6.4e-37 34.0 KIAA0149
AB053450 3.8e-16 27.1 KIAA1776
D87433 3.7e-14 25.7 KIAA0246
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR002049 341 359 PR00011 EGF-like
IPR002049 473 491 PR00011 EGF-like
IPR002049 819 837 PR00011 EGF-like
HMMPfam IPR011489 82 154 PF07546 EMI
IPR013111 247 273 PF07974 EGF
IPR013111 290 316 PF07974 EGF
IPR013111 333 359 PF07974 EGF
IPR002049 420 458 PF00053 EGF-like
IPR002049 594 633 PF00053 EGF-like
IPR002049 637 680 PF00053 EGF-like
IPR002049 686 710 PF00053 EGF-like
IPR013111 768 794 PF07974 EGF
IPR002049 811 854 PF00053 EGF-like
HMMSmart IPR006210 160 188 SM00181 EGF
IPR006210 199 231 SM00181 EGF
IPR002049 204 243 SM00180 EGF-like
IPR006210 242 274 SM00181 EGF
IPR002049 247 286 SM00180 EGF-like
IPR006210 285 317 SM00181 EGF
IPR006210 328 360 SM00181 EGF
IPR002049 333 372 SM00180 EGF-like
IPR006210 371 403 SM00181 EGF
IPR002049 376 416 SM00180 EGF-like
IPR006210 415 449 SM00181 EGF
IPR002049 420 461 SM00180 EGF-like
IPR006210 460 492 SM00181 EGF
IPR002049 465 504 SM00180 EGF-like
IPR006210 503 535 SM00181 EGF
IPR002049 508 547 SM00180 EGF-like
IPR006210 546 578 SM00181 EGF
IPR002049 551 590 SM00180 EGF-like
IPR006210 589 621 SM00181 EGF
IPR002049 594 633 SM00180 EGF-like
IPR006210 632 664 SM00181 EGF
IPR002049 637 680 SM00180 EGF-like
IPR006210 675 709 SM00181 EGF
IPR002049 683 721 SM00180 EGF-like
IPR006210 720 752 SM00181 EGF
IPR006210 763 795 SM00181 EGF
IPR002049 768 807 SM00180 EGF-like
IPR006210 806 838 SM00181 EGF
IPR002049 811 850 SM00180 EGF-like
IPR006210 849 881 SM00181 EGF
IPR002049 854 885 SM00180 EGF-like
ProfileScan IPR011489 82 159 PS51041 EMI
IPR000742 158 188 PS50026 EGF-like
IPR000742 196 231 PS50026 EGF-like
IPR000742 239 274 PS50026 EGF-like
IPR000742 282 317 PS50026 EGF-like
IPR000742 330 360 PS50026 EGF-like
IPR000742 368 403 PS50026 EGF-like
IPR000742 457 492 PS50026 EGF-like
IPR000742 505 535 PS50026 EGF-like
IPR000742 543 578 PS50026 EGF-like
IPR000742 591 621 PS50026 EGF-like
IPR000742 629 664 PS50026 EGF-like
IPR000742 717 752 PS50026 EGF-like
IPR000742 765 795 PS50026 EGF-like
IPR000742 803 838 PS50026 EGF-like
IPR000742 851 881 PS50026 EGF-like
ScanRegExp IPR013032 176 187 PS00022 EGF-like region
IPR013032 176 191 PS01186 EGF-like region
IPR013032 219 230 PS00022 EGF-like region
IPR013032 219 234 PS01186 EGF-like region
IPR013032 262 273 PS00022 EGF-like region
IPR013032 262 277 PS01186 EGF-like region
IPR013032 305 316 PS00022 EGF-like region
IPR013032 305 320 PS01186 EGF-like region
IPR013032 348 359 PS00022 EGF-like region
IPR013032 348 363 PS01186 EGF-like region
IPR013032 391 402 PS00022 EGF-like region
IPR013032 391 402 PS01186 EGF-like region
IPR013032 437 448 PS00022 EGF-like region
IPR013032 437 452 PS01186 EGF-like region
IPR013032 480 491 PS00022 EGF-like region
IPR013032 480 495 PS01186 EGF-like region
IPR013032 523 534 PS00022 EGF-like region
IPR013032 523 538 PS01186 EGF-like region
IPR013032 566 577 PS00022 EGF-like region
IPR013032 566 581 PS01186 EGF-like region
IPR013032 609 620 PS00022 EGF-like region
IPR013032 609 624 PS01186 EGF-like region
IPR013032 652 663 PS00022 EGF-like region
IPR013032 652 667 PS01186 EGF-like region
IPR013032 697 708 PS00022 EGF-like region
IPR013032 697 712 PS01186 EGF-like region
IPR013032 740 751 PS00022 EGF-like region
IPR013032 740 755 PS01186 EGF-like region
IPR013032 783 794 PS00022 EGF-like region
IPR013032 783 798 PS01186 EGF-like region
IPR013032 826 837 PS00022 EGF-like region
IPR013032 826 841 PS01186 EGF-like region
IPR013032 869 880 PS00022 EGF-like region
IPR013032 869 880 PS01186 EGF-like region

Prediction of transmembrane (TM) segments
Method No. N terminal transmembrane region C terminal type length
SOSUI2 1 909 GAIAGIIILVLVVLFLLALFII 930 PRIMARY 22
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f CAACAACAGGGACAGGATGAC
Primer_r CTGTCAAGTCCAAAAGCACCG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 5
Experimental conditions
Panel name GeneBridge 4
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp